155 Pages
English

Anaerobic degradation of limonene and p-xylene in freshwater enrichment cultures [Elektronische Ressource] / vorgelegt von Amelia-Elena Rotaru

-

Gain access to the library to view online
Learn more

Description

Anaerobic degradation of limonene andp-xylene in freshwater enrichmentculturesAmelia Rotaru2009Anaerobic degradation of limonene and p-xylene infresh-water enrichment culturesDissertationzurErlangung des Grades einesDoktors der NaturwissenschaftenDr. rer. nat.Fachbereich Biologie/Chemieder Universität Bremenvorgelegt vonAmelia-Elena RotaruausRamnicu ValceaRomaniaBremen, 20093Die Untersuchungen zur vorliegenden Doktorarbeit wurden am Max-Planck-Institut für Ma-rine Mikrobiologie in Bremen durchgeführt.Gutachter 1: Prof. Dr. Friedrich Widdel, Universität BremenGutachter 2: PD Jens Harder, Max Planck Institut für Marine Mikrobiologie4Aceasta carte este dedicata parintilor mei care m-au sustinut cudragoste si incredere, de-a lungul acestei „calatorii“ in necunoscut.56ContentsI Anaerobic aliphatic hydrocarbon degradation 151 Anaerobic degradation of saturated aliphatic hydrocarbons 172 Anaerobic of unsaturated aliphatic hydrocarbons 213 Anaerobic limonene degradation: results and discussions 253.1 Scope of the study .................................253.2 Degradation of limonene under methanogenic conditions ...........263.3 Microbial community composition . . .......................303.4 Isolation of novel Deltaproteobacteria ......................373.5 Conclusions and outlook..............................

Subjects

Informations

Published by
Published 01 January 2009
Reads 58
Language English
Document size 6 MB

obicAnaer

p

degradation

-xylene

in

of

freshwater

cultures

Amelia

uRotar

2009

limonene

and

hmentenric

Anaerobicdegradationoflimoneneandp-xylene

cultureshmentenricfresh-water

tationDisser

zur

ErlangungdesGradeseines

derDoktorsNaturwissenschaften

nat..rer.Dr

Biologie/ChemieachbereichF

UnivderBremenersität

novorgelegtv

uRotarAmelia-Elena

aus

alceaVRamnicu

Romania

2009Bremen,

in

3

4

DieUntersuchungenzurvorliegendenDoktorarbeit
rineMikrobiologieinBremendurchgeführt.

hterGutachterGutac

1:2:

.rD.ProfJensPD

wurden

am

FriedrichWiddel,UniversitätBremen
Harder,MaxPlanckInstitutfürMarine

k-InstitutMax-Planc

Mikrobiologie

für

Ma-

Aceasta

dragoste

car

si

te

este

dedicata

,incredere

de-a

par

intilor

lungul

mei

acestei

care

m-au

„calator

ii“

in

utsustin

cu

necunoscut.

5

6

Contents

IAnaerobicaliphatichydrocarbondegradation
1Anaerobicdegradationofsaturatedaliphatichydrocarbons
2Anaerobicdegradationofunsaturatedaliphatichydrocarbons
3Anaerobiclimonenedegradation:resultsanddiscussions
3.1Scopeofthestudy.................................
3.2Degradationoflimoneneundermethanogenicconditions...........
3.3Microbialcommunitycomposition.........................
3.4IsolationofnovelDeltaproteobacteria......................
..............................outlookandConclusions3.5erencesRef4

15172125526203739341

IIAnaerobicaromatichydrocarbondegradation49
5Monoaromatichydrocarbondegradation51
6Polyaromatichydrocarbondegradation59
7Anaerobicp-xylenedegradation:resultsanddiscussions61
7.1Scopeofthestudy.................................61
7.2Cultivationofp-xylenedegradingmicroorganismsunderdenitrifyingconditions62
7.2.1Enrichment.................................62
7.2.2Isolationattempts.............................62
7.2.3Growthtestsonotherhydrocarbons...................63
7.3DominanceofnovelBetaproteobacteriainp-xylenedegradingenrichment
36.......................................cultures7.4Quantificationofp-xylenedegradation......................66
7.5Mechanismofp-Xyleneactivation........................67
7.6Conclusionsandoutlook..............................70
73erencesRef8

7

Contents

9

III

10

11

12

13

14

8

utioncontribofExplanation

uscriptsMan

1uscriptMan

2uscriptMan

3uscriptMan

sexAnne

wledgmentsknoAc

83

85

78

113

129

151

153

viationsabbreofList

BssAα-subunitofbenzylsuccinatesynthase

bssAgeneencodingtheα-subunitofbenzylsuccinatesynthase

BTEXbenzene,toluene,ethylbenzene,xylenes

CARD-FISHcatalyzedreporterdeposition-fluorescenceinsituhybridization

APID

0’GΔ

FISH

GC

HAP

RNA

rRNA

(4’,6-diamidino)ylindol2-phen

7.00)pHatm,1,C(25°conditionsstandardunderenergy)(freeGdelta

fluorescentinsituhybridization

yaphrchromatoggas

ydrocarbonsharomaticpoly

ucleicibonracid

RNAibosomalr

SDS-PAGEsodiumdodecylsulfate-polyacrylamidegelelectrophoresis

SR

SRB

TEA

atesulfreduction

iabacterreducingatesulf

electronminalteracceptor

9

Contents

10

ySummar

Theanaerobicdegradationofhydrocarbonshasbeenintensivelyexploredinthelastdecade
yieldinginsightsintonewphysiologicalcapabilitiesandbiochemicalpathways.However,for
afewhydrocarbons,e.g.p-xylene,itprovedtobemoredifficulttoenrichmicroorganisms
andtoisolatepurestrains.Thermodynamically,themineralizationofhydrocarbonsisleast
favorableunderanoxicconditionsandespeciallyundermethanogenicconditions.Inmy
thesis,twoenrichmentcultureswerecharacterized,amethanogenicfreshwaterenrichment
culturegrownonlimonene,themostabundantmonoterpeneinnature,andadenitrifying
freshwaterenrichmentculturegrownonp-xylene.
Themethanogenicenrichmentcultureconsumedlimonenewithproportionalformationof
methane.Thefullcycle16SrRNAgeneapproachrevealedthepresenceofArchaearelated
toMethanosaetaandMethanoculleusandBacteriarelatedtoSyntrophobacteraceae,Bac-
teroidetes,andtheCandidateDivisionOP3.ThiscandidatephylumlieswithinthePlancto-
mycetes,Chlamydiae,Verrucomicrobia,Lentisphaeraesuperphylumandhasnomember
inculture.HencenucleicacidprobesweredevelopedtotargettheOP3-phylotype.The
probedetectedverysmallsphericalcells,whichlivedaloneorattachedtolargercellsand
represented18%ofthetotalDAPI-stainedpopulation.Thustheymayplayanimportant
roleinlimonenedegradation.TheotherBacteriaweremainlyDeltaproteobacteria(13%),
andonly1%wereBacteroidetes.TogetherwithanewEUB-338probespecificfortheOP3
cells,thebacterial338probemixturedetected40%ofthetotalcellswhereastheArchaea
probedetected33%.Thepresenceofseveralphylotypessuggeststhatmorethenonesyn-
trophicbacteriumandonemethanogenicarchaeonareinvolvedinlimonenedegradation
tomethanegasandcarbondioxide.
Syntrophicbacteriawereisolatedusingfumarateandlactateasorganicsubstratesfor
fermentation.AllsevenstrainsbelongedphylogeneticallytoDeltaproteobacteria,with11%
16SrRNAgenedissimilaritytoDesulfoarculusbaarsii.Initialco-cultureexperimentswith
Methanosarcinamazeishowedgrowthonlactateorfumarateinthepresenceoflimonene.
However,theirroleinlimonenedegradationcouldnotdemonstrated.
Denitrifyingenrichmentcultureswereestablishedwithafreshwatersedimentmixand
p-xyleneassoleelectrondonorandcarbonsource.Severalbatchtransfersandliquid
dilution-to-extinctionseriesenrichedacurvedrodmorphotype,0.5×2μminsize.This
dominantmorphotype(96%ofallcells)wasaswellidentifiedasthedominantphylotype
(91-95%)usingthe16SrRNAfullcycleapproach.Theorganismaffiliatedphylogeneti-
callywithBetaproteobacteriaandnotwithotheranaerobichydrocarbondegradingmicroor-
ganismsfromtheAzoarcus-Thaueraclade.Theirclosestrelativewasagroupofsteroid-

11

Contents

degraders:Denitratisomaoestradiolicum,Sterolibacteriumdenitrificansandstrain72Chol.
Thisenrichmentculturescoupledcompletemineralizationofp-xylenetodenitrificationof
nitratetodinitrogengas.Bygaschromatographymassspectrometricanalysisofmetabo-
litesfoundincellextracts,(4-methylbenzyl)succinateand(4-methylbenzyl)itaconatewere
identified,supportinganactivationmechanismbyadditiontofumarate.Agenefragmentfor
abenzylsuccinylsynthasecouldbesequenced,andrevealedaminoacidsimilaritieswith
TutDfromthewellknowntoluenedegradingdenitrifier,Thaueraaromatica.
Thisstudyhasrevealedthatanaerobichydrocarbondegradationinvolvesabroaddiver-
sityofmicroorganism,evenoutsidethephylumProteobacteria.Mythesisestablishedthe
participationofnovelorganismstoanaerobichydrocarbondegradationandrevealedforthe
firsttimethemorphologyofCandidatephylumOP3cells.

12

Introductoryremarksonanaerobic
degradation

Deepsedimentlayersoflakes,riversandsoils,aswellaquifersandundergroundwaters,
hostorganismscapabletodegradeorganicmatter.Inthesehabitatsoxygenislimiting,
soanaerobiclifeistheonlyalternative.Today,twotypesareknown,fermentationand
respirationofalternativeelectronacceptors.Nitrate,metals(Fe3+orMn4+),sulfateor
carbondioxidearethemajorelectronacceptorsrespiredbymicroorganisms.
InmythesisIwillfocusontwodifferentanaerobicrespiratoryprocesses,havingastermi-
nalelectronacceptors1)nitrateand2)carbondioxide.Inbothcasesthemicroorganisms
gainedenergybydegradationofhydrocarbons.
Hydrocarbonsareanubiquitousclassofnaturalcompoundsthatconsistsolelyofhy-
drogenandcarbonatoms.Therearetwomajorcategoriesofhydrocarbons,aliphaticand
aromatic.Aliphatichydrocarbonsaresaturated(alkanes)andunsaturated(alkenesand
alkynes),linear(e.g.n-alkanes),branchedorcyclic,whereasaromatichydrocarbonsare
characterizedbythepresenceofoneormorebenzenerings(mono-orpolycyclic)which
canbesubstitutedbyaliphaticalkylgroups(e.g.alkylbenzenes).Somehydrocarbons
areproducedbyplants(CheesbroughandKolattukudy,1984;Singeretal.,2003),animals
(HylemonandHarder,1999),insects(Pageetal.,1997),andmicroorganisms(Birchand
Bachofen,1988;HarderandFoss,1999).Saturatedaliphaticandaromatichydrocarbons
arealsoformedatveryhightemperaturesandpressures,afterdepositionandsedimenta-
tionofdeadorganicmatter.Thesearethemainconstituentsofoilandnaturalgas(Tissot
andWelte,1984).Besides,numeroushydrocarbonsareextensivelyproduced,orrefinedin
industryfordifferentpurposes.Becausehydrocarbonsarewidespreadintheenvironment,
themicrobesdegradingthemareexpectedtobeasubiquitous(SpormannandWiddel,
2000).Inthelastthreedecades,anaerobicmicrobescapableofhydrocarbondegradationwere
studiedextensively(Widdeletal.,2006)especiallytheonesmediating„useful“processes.
Bioremediationofpetroleumpollutedenvironmentsorobtainingnovelindustrialbiocata-
lystsaresomeexamples.Beyondtheapplicationsofanaerobichydrocarbondegradation,
theultimategoalistoidentifyunusualenzymesandreactionscatalyzedbymicrobes,to
theirdiscovenerhowvironment,interandactionswhatareroleestablishedanaerobicbetwheenydrocarbonorganismsdegrandadersbetwplayeenintheorganismsglobalcar-and
.cyclebon

13

Contents

14

obicAnaer

trPa

I

aliphatic

ydrhocarbon

degradation

15

1Anaerobicdegradationofsaturated
ocarbonsydrhaliphatic

Saturatedaliphatichydrocarbonsoralkanesarenonreactivehydrocarbonswhichcontain
exclusivelyapolarσ-bonds.Theyareconstituentsofpetroleumandnaturalgasandenter
thebiospherefromgasseepsandundergroundoilplumes,orareproducedbymicroor-
ganismsandplants(TissotandWelte,1984;CheesbroughandKolattukudy,1984;Birch
andBachofen,1988).Inthepresentworld,oilrefineries,chemicalindustryandhuman
activitiesaresupplementarysourcesofalkanesintheenvironment.
Denitrifyingbacteriadegradingalkaneshadbeenisolatedfromditchsediments(Ehren-
reichetal.,2000)whereasmesophilicsulfatereducingbacteriawereisolatedfromoilfields,
oilwaste-waters(strainHxd3,Desulfoglaebaalkanexedens),petroleumcontaminatedes-
tuarysediments(strainAK-01),marinesediments(Desulfatibacillumaliphaticivorans),and
deepseahydrocarbonseeps(strainBuS5)(Aeckersbergetal.,1991,1998;SoandYoung,
1999;Cravo-Laureauetal.,2004a;Davidovaetal.,2006;Kniemeyeretal.,2007).Cold
adaptedalkanedegradingorganismshavenotbeendescribedyet.However,thepotential
foralkanedegradationwasobservedatlowtemperaturesinsulfatereducingenrichment
culturesgrowingwithethaneat12°C(Kniemeyeretal.,2007).Onethermophilicisolate,
hadbeenpurifiedfromGuyamasbasinsedimentsanddegradesC6-C16n-alkaneswhile
growingoptimallyat60°C(Rueteretal.,1994).Thermophilicpropanedegradingbacteria
werealsoenrichedfromGuyamasbasinsediments(Kniemeyeretal.,2007).Sofarthere
arenostudiesonn-alkanedegradationunderironreducingconditions,andonlyfewstudies
showedn-alkanedegradationundermethanogenicconditions(Zengleretal.,1999;Ander-
sonandLovely,2000).Branchedandcyclicalkaneshadbeenlessstudiedalthoughitwas
showntheycanbeutilizedundersulfatereducingordenitrifyingconditionsinenrichments
fromcontaminatedaquifers(Bregnardetal.,1997;Rios-Hernandezetal.,2001).

yenylogPhAllisolated,describedanaerobicmicrobes(Table1.1)capabletodegradealkanesare
groupedwithinthephylumProteobacteria(WiddelandRabus,2001;Widdeletal.,2006;
Wentzeletal.,2007).DenitrifiersthatutilizealkanesbelongtotwodifferentProteobacteria
classes,BetaproteobacteriaandGammaproteobacteria(Ehrenreichetal.,2000).Whereas,
sulfate-reducingbacteriadegradingalkanes,groupwithinDeltaproteobacteria(Aeckers-
bergetal.,1991,1998;SoandYoung,1999;Cravo-Laureauetal.,2004a;Davidovaetal.,

17

1Anaerobicdegradationofsaturatedaliphatichydrocarbons
2006;Kniemeyeretal.,2007)andarerelatedtoDesulfosarcina-Desulfococcusgroup
orareclassifiedasmembersoftwonovelgenus,Desulfatibacillum(Cravo-Laureauetal.,
2004a)andDesulfoglaeba(Davidovaetal.,2006).

Table1.1:Isolatedmicroorganismscapableofalkaneutilizationunderanaerobicconditions.
PHYLUMORGANISMALKANERESPIRATIONREFERENCE
β-ProteobacteriaAzoarcussp.strainHxN1C6-C8Nitrate(Ehrenreichetal.,2000)
β-ProteobacteriaStrainOcN1C8-C12Nitrate(Ehrenreichetal.,2000)
γ-ProteobacteriaStrainHdN1C14-C20Nitrate(Ehrenreichetal.,2000)
γ-ProteobacteriaMarinibactersp.BC-36,38,42C18Nitrate(Boninetal.,2004)
γ-ProteobacteriaPseudomonasbalearicasp.BerOC6C15-C18Nitrate(Grossietal.,2008)
δ-ProteobacteriaStrainBuS5C3-C4sulfate(Kniemeyeretal.,2007)
δ-ProteobacteriaDesulfoglaebaalkanexedensLakeC6-C10sulfate(Davidovaetal.,2006)
δ-ProteobacteriaDesulfoglaebaalkanexedensALDCC6-C12sulfate(Davidovaetal.,2006)
δ-ProteobacteriaStrainTD3C6-C15sulfate(Rueteretal.,1994)
δ-ProteobacteriaStrainHxd3C12-C20sulfate(Aeckersbergetal.,1991)
δ-ProteobacteriaStrainPnd3C14-C17sulfate(Aeckersbergetal.,1998)
δ-ProteobacteriaStrainAK-01C13-C18sulfate(SoandYoung,1999)
δ-ProteobacteriaDesulfatibacillumaliphaticivoransC13-C18sulfate(Cravo-Laureauetal.,2004a)

ationactivofhanismMecTwomechanismsforalkaneactivationunderanaerobicconditionshavebeenproposed
(Figure1.1):(1)homolyticC-Hbondcleavagefollowedbyadditiontofumarateand(2)
carboxylation(SpormannandWiddel,2000;WiddelandRabus,2001;Widdeletal.,2006;
Wentzeletal.,2007).
(1)Thesuggestedadditiontofumarateissupportedby:i)identificationofalkylsuccinates
incellextractsofenrichmentculturesandpurecultures(Kroppetal.,2000;Rabusetal.,
2001;Rios-Hernandezetal.,2001;Callaghanetal.,2006),ii)thepresenceofC-even
fattyacidsorC-odd-alkanefedculturesandC-oddormethylbranchedfattyacidsinC-
even-alkanefedcultures,iii)thedetectionofdeuteriumlabeled(methylalkyl)succinateafter
incubationwithlabeledalkane(Callaghanetal.,2006),iv)thedetectionofanorganic
radicalbyelectronparamagneticresonance(EPR)spectroscopy(Rabusetal.,2001)which
suggeststheexistenceofaradicalenzyme,andv)thesequencingofgenes,potentially
encodingthesubunitsof(methylalkyl)succinate-synthaseofcellsgrownonann-alkane
(Grundmannetal.,2008).Analternativeadditionmechanismtofumaratewasobservedby
metaboliteanalysis,andfattyacidprofilingofpropanegrowingcultures(Kniemeyeretal.,
2007).Intheseculturestheexpected(isopropyl)succinatewasnotfound,but(n-propyl)
succinatewasidentifiedsuggestinganactivationbothbyadditionofthesecondaryand
terminalcarbonofpropanetofumarate.Thismechanismcouldbeespeciallyusefulfor
ethaneactivation,thatconsistsonlyofterminalcarbonatoms(Kniemeyeretal.,2007).

18

1.1:Figure

ationActivofn-alkanesybadditiontoatefumaratthesecondaryandprimarycarbonatomandcarboxylationtothethirdcarbonatom
(modifiedfromKniemeyeretal.(2007);Grossietal.(2008)).With
redarespecifiedthecarbonatomswherethealkaneisactivated.

(2)Theotheractivationmechanismforn-alkanesiscarboxylationatthetertiarycarbon
atom(Soetal.,2003)assuggestedforthesulfatereducingstrainHxd3(Aeckersbergetal.,
1991,1998).ThisorganismwhengrownonC-oddorC-evenalkaneshasaC-evenorC-
oddfattyacidcompositionwhichresultsfromalkanecarboxyladditionatC3,subsequently
followedbylossoftwosubterminalcarbonatoms(Soetal.,2003).

19

1

Anaerobic

20

adationrdeg

of

atedsatur

aliphatic

ydrocarbonsh

2Anaerobicdegradationofunsaturated
ocarbonsydrhaliphatic

Unsaturatedaliphatichydrocarbonsarecharacterizedbythepresenceofdouble(alkenes)
ortriple(alkynes)bounds.Aparticularcategoryofalkenesareisoprenoidsoraliphaticter-
penes,derivedfromisopreneunitswithorwithoutothersubstituents(e.g.hydroxylgroups).
AccordingtothenumberofC5-unitstheyaresubdividedintohemiterpenes(C5,e.g.iso-
prene),monoterpenes(C10,e.g.limonene),sesquiterpenes(C15),diterpenes(C20),triter-
penes(C30,e.g.squalene),tetraterpenes(C40,e.g.β-carotene)andotherpolyterpenes
(>C45,e.g.gutta-percha).Mono-andsesquiterpenesarethechiefconstituentsofplant
essentialoilswhiletheotherareconstituentsofresins,waxes,balsamsandrubber.Mono-
andsesquiterpenesareproducedassecondarymetabolitesbyplants,wheretheyare
usedasrepellents,attractants,ortomaintainintegrityagainststresscausedbydehydra-
tion(KesselmeierandStaudt,1999).Alkenesareubiquitous,naturallyoccurringasthey
aresynthesizednotonlybyplantsbutalsobymicroorganisms,insectsandlargerorgan-
.ismsAliphatichydrocarbonswithtripleboundsarenotcommoninnature.TheEarth’sat-
mospherehasonlytraceamountsofacetylene(0.00004ppm),whereasonotherplanets
fromourSolarSystem(JovianplanetsandTitan)acetyleneisinappreciableamounts(up
to4ppm),whereitisprobablyformedbyphotolysisofmethane(OremlandandVoytek,
2008).SuchanatmosphericcompositionofacetylenewaspredictedfortheArcheantimes
ofourplanet.Therefore,acetyleneisconsideredapotentialkeyplayerinthebioenerget-
icsandevolutionofEarth’sfirstanaerobicecosystem,andthereisalotofinterestinits
biodegradation(OremlandandVoytek,2008).
Ingeneral,unsaturatedbondsaremorepronetoattackthanthesimplesigmabondsin
alkanesoraromaticbonds.Bothalkenesandalkynescouldberelativelyeasilydegraded
chemicallyaswellasbiologically.Asaresulttheyarerarelyfoundinpetroleumandcon-
densates,wheretheiroriginisrelatedtoabiogenicalterationofn-alkanesratherthentothe
preservationoftheoriginalmolecules(CurialeandFrolov,1998).
Microorganismscapableofunsaturatedaliphatichydrocarbondegradationunderanaer-
obicconditions,wereisolatedfrompetroleumpollutedmarinesediments(Aeckersberg
etal.,1998;Cravo-Laureauetal.,2004a,b),brackishorfreshwateranoxicmud(Schink,
1985b;SoandYoung,1999;Cravo-Laureauetal.,2007),oilproductionplantswastewa-
ters(Aeckersbergetal.,1991),activatedsludgeandforestditches(Fossetal.,1998;Foss
andHarder,1998).Untilnowtherearenoproofsofunsaturatedaliphatichydrocarbon

21

2Anaerobicdegradationofunsaturatedaliphatichydrocarbons
degradationinironreducingconditions.However,undermethanogenicconditions,ithad
beenshownthatbothalkenesandalkynescanbedegraded(Schink,1985a,b;Harderand
1999).oss,F

Table2.1:Isolatedmicroorganismscapableofalkeneutilizationunderanaerobicconditions.Allalkenesare1-enewhen
notspecified.(M)standsforcyclicisoprenoicalkenes(monoterpenes),withoneortwodoublebonds(dienes)at
differentpositionswithinthecycleoronthealkylchain.(T)isforthetriterpenesqualenewithsixdoublebounds.
PHYLUMORGANISMALKENERESPIRATIONREFERENCE
β-ProteobacteriaThaueraterpenicaC10(M)Nitrate(FossandHarder,1998)
β-ProteobacteriaCastellanielladefragransC10(M)Nitrate(Fossetal.,1998)
γ-ProteobacteriaPseudomonasbalearicaBerOC6C17Nitrate(Grossietal.,2008)
γ-ProteobacteriaMarinobactersp.2sq31C30(T)Nitrate(Rontanietal.,2002)
δ-ProteobacteriaStrainHxd3C14,C16,C18sulfate(Aeckersbergetal.,1991)
δ-ProteobacteriaStrainPnd3C14,C16,C18sulfate(Aeckersbergetal.,1998)
δ-ProteobacteriaStrainAK-01C15,C16sulfate(SoandYoung,1999)
δ-ProteobacteriaDesulfatibacillumaliphaticivoransC7-C23sulfate(Cravo-Laureauetal.,2004a)
δ-ProteobacteriaDesulfatibacillumalkenivoransC8-C23sulfate(Cravo-Laureauetal.,2004b)
δ-ProteobacteriaDesulfatiferulaolefinovoransC14-C23sulfate(Cravo-Laureauetal.,2007)

yenylogPh

Denitrifying,sulfatereducing(Table2.1)orfermenting(Schink,1985b)isolatescapableof
unsaturatedaliphatichydrocarbondegradationareallclusteredinthesameProteobacteria
phylumasotherhydrocarbondegradingmicroorganisms.Denitrifyingstrains,isolatedon
n-alkenesandaliphaticmonoterpenes(e.g.α-terpinene,limonene)belongtothesame
Proteobacteriaclassesasn-alkanedegradinganaerobes,namelyBetaproteobacteriaand
Gammaproteobacteria.Theonlydescribeddenitrifierdegradingn-alkeneswasassoci-
atedwithPseudomonas(Grossietal.,2008),whereasdenitrifyingalkenoicmonoterpene
degradersgroupedwithotheranaerobichydrocarbondegradingmicroorganismsfromthe
genusThauera(FossandHarder,1998)andthenewlydescribedgenusCastellaniella
(FossandHarder,1998;Kampferetal.,2006).Sulfatereducingisolatesareallmembers
ofDeltaproteobacteriaandgroupwithintheDesulfosarcina-Desulfococcusgroup(Aeck-
ersbergetal.,1991,1998;SoandYoung,1999),andtwonewgeneraDesulfatibacillum
(Cravo-Laureauetal.,2004b,a)andDesulfatiferula(Cravo-Laureauetal.,2007).Theonly
alkynedegradingstrainisolateduntilnowistheacetyleneutilizer,Pelobacteracetylenicus
(Schink,1985b)whichbelongstoagenuswithinDeltaproteobacteria,thatcomprisesof
strictlyanaerobicGramnegativebacteriawhichcouldactasimportantsyntrophicoxidants
ofprimaryaliphaticalcoholsinsedimentsandsludges(Schink,2006).

22

ationactivofhanismMecInafirststudyonanaerobicdegradationofunsaturatedhydrocarbons,Schink(1985a)
demonstratedmineralizationofhexadeceneundermethanogenicconditionsandspecu-
latedontheactivationbyadditionofhydroxyl-groupsatthedoublebound(Schink,1985a).
Recentstudiesbroughtevidenceforthispathway,byrecoveryof[deuterated]-fattyacids
and-alcoholsfromculturesgrownonlabeledhexadeceneandpentadecene(Soetal.,
2003;Grossietal.,2007,2008).Theattackseemstobeinitiatedatthedoubleboundby
ahydroxylase,resultinginthecorrespondingalcohols,andaswellbytheadditionofun-
definedorganiccarbonunits(methylorethyl-groups)atsubterminalcarbonatomsofthe
carbonchain.Inthecaseofthemultiplealkenoicterpene,squalene,theattackhadbeen
proposedtooccur,aswell,byhydrationofdoubleboundstosymmetrictertiarydiolsas
seeninMarinobacterstrain2sq31underdenitrifyingconditions(Rontanietal.,2002).
Forcyclicalkenoicmonoterpenesitwaspreviouslysuggestedthat(e.g.α-pinene,limonene,
2-carene)theattackisinitiatedatthesp2-hybridizedC1atom.Whereasifthereactionoc-
curredatanisolatedsp2Catom,theresultingcarbocationcouldnotbestabilized.Arear-
rangementsofπ-bondssotheC1atombecomessp2hybridizedwasobservedinC.defra-
gransgrownonamonoterpenecontainingansp3hybridizedC1atom(HeyenandHarder,
1998).Itwassuggested(HylemonandHarder,1999)thatmonoterpenesaretransformed
intoaninitialioniccompoundwhichstaysintracellularforuseinmetabolism.Laterithad
beenshownthatgeranicacidisformedduringgrowthofC.defragransondifferentcyclic
alkenoicmonoterpenes(HeyenandHarder,2000).Today,thereisnootherinformationon
theringopeningortheinitialattackofcyclicmonoterpenes.Theunderstandingofalkene
metabolisminanaerobicmicroorganismisstillafieldofactiveresearch,andnovelenzymes
andreactionsaretobediscovered.
Acetyleneistheonlyunsaturatedaliphatichydrocarbonwhoseactivationwasstudied
underfermentingconditionsinPelobacteracetylenicus(Schink,1985b).Thehydratingre-
actionofacetylenetoacetaldehydeiscatalyzedbyamonomerictungsten-[4Fe-4S]protein,
acetylene-hydratase(Meckenstocketal.,1999;Einsleetal.,2005;Seiffertetal.,2007).
Theactivityofthisenzymeisextremelyoxygensensitiveandisirreversiblylostuponex-
posuretoairwiththedegradationofthe[4Fe-4S]cluster(Meckenstocketal.,1999).The
tungstencenterbindsawatermoleculethatisactivatedbyanaspartateresidue.Theactive
watermoleculewillfurtherattackacetylene,howeveritisyetunknowniftheactivewater
moleculewillactasanelectrophileornucleophileduringtheattack(Seiffertetal.,2007).

23

2

Anaerobic

24

adationrdeg

of

atedunsatur

aliphatic

ydrocarbonsh

obicAnaer3degradation:limonenediscussionsandresults

3.1Scopeofthestudy

Reason:Decayedplantmaterialistransportedbyrain,runoffandwindintoriversand
lakes,especiallyduringautumnfoliage,whenlargeamountsofalkenoichydrocarbons,
likemonoterpenesaredepositedandsedimented.Deepersedimentlayersareafavor-
ablehabitatofanaerobicmicrobes,andwhenalltheelectronacceptorsareconsumed
onlymethanogeniccommunitiescandegradetheremainingorganicmatter.Previousstud-
iesshowedthatalkenoicmonoterpenes,suchas2-careneandα-pinene,canbede-
gradedundermethanogenicconditions.Interestingly,whenculturesweregrownonother
twomonoterpenes,α-phellandreneandsabinene,thesetwomonoterpeneswerearoma-
tizedtop-cymene(HarderandFoss,1999;FossandHarder,1998).Limonene,themost
widespreadmonoterpene,canbedegradedunderdenitrifyingconditions(Fossetal.,1998;
FossandHarder,1998).However,thereismoretolearnaboutitsbiomineralizationunder
anaerobicconditionssincethebiologyinvolvedinitsdegradationisyetnotunderstood.

Scope:Thisworkfocusedonamethanogenicenrichmentculturedegradinglimonene
withthefollowingaims:

1.todemonstratelimonenedegradationundermethanogenicconditions.
2.toidentifyandquantifythemembersofthemicrobialcommunityinmethanogenic
limonenedegradingenrichmentusingamolecularapproach(Amannetal.,1995).
3.toisolatemicroorganismsthatarepotentiallyinvolvedinsyntrophiclimonenedegra-
dation,anddetermineiflimonenecouldhaveatoxiceffectontheirgrowth.
4.toclarifyifthenewisolatesplayaroleinlimonenedegradationinthepresenceofa
.tnerparmethanogenic

(seePartII-7.1)

25

3Anaerobiclimonenedegradation:resultsanddiscussions

3.2Degradationoflimoneneundermethanogenic
conditions

Earlierstudiessuggestedthatmonoterpenesundergonon-biologicalcatagenicprocesses
inanoxicenvironmentsratherthanbiologicaltransformations(TissotandWelte,1984).
However,latestresearchdidshowbiodegradationofalkenoicterpenesaswellasofother
alkenesundermethanogenicconditions(HarderandFoss,1999;Schink,1985a).Re-
gardlessoftheabundanceoflimoneneinnature,itsbiodegradationundermethanogenic
conditionswasneverstudied.
Thisstudywasinitiatedbyincubationofenrichedcultures(HarderandFoss,1999)inthe
absenceofanelectronacceptorwith5%limonene(vol/volinHMN).Cultureswithavolume
of300mlaccumulatedmorethenthreelitersofgasincircatwoyears.After14transfers,
wemonitoredenrichmentsforcirca7months,todemonstratelimoneneutilizationunder
methanogenicconditions.Cultureswereincubatedwithdifferentconcentrationoflimonene
(2%or5%inHMN)inthepresenceorabsenceofadditionalacetate(2mM).
Aftercirca3monthsoflagphasetheopticaldensityincreasedandreacheditsmaximum
duringthe6thmonthofincubation(Figure3.1A).Theconsumptionoflimonene(Figure
3.1B)rangedbetween22%and48%fromthetotallimoneneadded(Table10.2).Cultures
withoutacetateshowedalargerconsumptionoflimonenerangingbetween22%and48%
ofthetotallimoneneadded.Insterilecontrolsthelimoneneamountdidnotdecrease
significantly(Figure3.1B).Allenrichmentculturesreleasedmethanegas(Figure3.1C)
whichcorrespondedtotheamountoflimoneneconsumed(45%to75%methanerecovery)
(Table10.2).Weaddedacetateandcysteinesincethesearerequiredgrowthfactorsor
stimulatorynutrientsfordifferentgroupsofmethanogens(Whitmanetal.,2006).However,
somemicroorganismscouldusethesecompoundsasorganicenergysources(Whitman
etal.,2006).Ourdata(Table10.2)supportthestoichiometry:C10H16+6H2O→7CH4+3
CO2Inculturesincubatedwith2%limoneneinHMN(v/v)andwithoutadditionalacetate,
weobservedthatacetatewastransitoryformed(0.6mMto1.75mM)(Figure3.1A).In
thesecultureswithoutacetatemethaneproductionstartedlater(Figure3.1C)compared
tolimonenedegradingculturessupplementedwithacetate.Itispossiblethatsubstrate
fermentationisdecoupledfrommethanogenesis.Thereforeintheabsenceofacetate,
acetate-dependentmethanogenswouldnotsurvive.Theadditionandaccumulationofac-
etatewasreportedtoinhibitsyntrophicdegradationoffattyacidsandbenzoate(Ahringand
Westermann,1987;Fukuzakietal.,1990;Warikooetal.,1996).Itispossiblethatlarger
amountsofacetatecouldhavean„end-metabolite“inhibitoryeffectonthesyntrophicmi-
crobialcommunity,andfinallyonthelimonenedegradationprocessitself.However,such
inhibitoryeffectwasnotobservedinculturesincubatedonlimonene(5%v/vinHMN)inthe
mM).(2acetateofpresence

26

3.2Degradationoflimoneneundermethanogenicconditions

RELEASINGREACTION-ACETATEANDHYDROGENASTRANSFERMETABOLITES
ydrogen:handacetateReleasingC10H16+10H2O→5C2H4O2+8H2{ΔG0’=+156kJoule(mollimonene)−1}
CTIONSREAONSUMINGCacetate:ConsumingC2H4O2→CH4+CO2{ΔG0’=-49kJoule(molmethane)−1}
ydrogen:hConsuming4H2+CO2→CH4+2H2O{ΔG0’=-131kJoule(molmethane)−1}
RELEASINGREACTION-FORMATEANDHYDROGENASTRANSFERMETABOLITES
Releasingformateandhydrogen:
C10H16+20H2O→10CH2O2+18H2{ΔG0’=+949kJoule(mollimonene)−1}
CTIONSREAONSUMINGCmate:rofConsuming4CH2O2→CH4+3CO2+2H2O{ΔG0’=-284kJoule(molmethane)−1}
ydrogen:hConsuming4H2+CO2→CH4+2H2O{ΔG0’=-131kJoule(molmethane)−1}
TOTALLIMONENEDEGRADATION
C10H16+6H2O→7CH4+3CO2{ΔG0’=-348kJoule(mollimonene)−1}

Limonenedegradationintheabsenceofanelectronacceptor,islessexergonicwhen
comparedtoaerobicorotheranaerobicrespiratoryprocesses.Consequently,microorgan-
ismsadapttotheexploitationofminimalenergyspans,byestablishingmutualisticinterac-
tions-syntrophy.Insuchmicrobialco-operativeinteractionthecarbonandelectronflow
followsarathersimplepattern.Polymersarehydrolyzedintooligo-andmonomersbyex-
tracellularenzymesproducedbyprimaryfermentingbacteria(SchinkandStams,2006).
Theseorganismsfermentthemonomersfurthermoretofattyacids,alcohols,succinate,
lactateetc.Secondaryfermentersorsyntrophicbacteriaconverttheshortchainfattyacids
andalcoholstoacetate,formate,hydrogenandcarbondioxide.Methanogensactasscav-
engersofreducingequivalents,whichotherwisewouldinhibitfurtherdegradationofthe
initialsubstrate(SchinkandStams,2006;Stamsetal.,2006).
Asimilarmicrobialfood-chaincoulddegradelimonene(Figure3.2).Fermentingbacteria
coulddegradelimonenetodifferentfattyacidsandalcoholsandthenbreakthemdown
tosmallermolecules.Syntrophicbacteriacouldutilizesmallerfattyacidsassubstrates
andtheircatabolicend-productswouldfeedthemethanogeniccommunity(Figure3.2).
Acetatebuild-upandconsumptioninculturesincubatedwithlimonene,suggestacetate
exchangebetweensyntrophsandmethanogens.Similarly,acetatewasregardedasa
likelyintermediateforalkanedegradationundermethanogenicconditions(Dolfingetal.,
2008).

27

3Anaerobiclimonenedegradation:resultsanddiscussions

28

×2H4O2→CH4+CO2theinmediathetoaddedsuspensioncellatedconcentramount.mentioned
andii)4C3H7(aluevtheoreticalthetorelationinculturesybproducedmethaneofpercentagetheiseredvrecomethane***The02sawinocula**TheCi)equations:thefromcalculated*cysteandacetatefrommedrofmethanetheoreticaltheWhereas1.equationtoaccordingcalculatedsawlimonenefrommedrofmethanetheoreticalThe
NO2S+H2O→5CH4+7CO2+4NΣHCH32.elyrespectiv,S
4cysteine).andacetatelimonenefrom+4H
inewas

Inoculav/v)(%limonene(mmol)Initiallimonene(mmol)Final-0.3--0.1--**1.3l164Ctr500.3-15.48.22.44.6**1.3164B650.3-14.09.72.64.6**1.3164A970.30.6-0.9--01l165Ctr450.30.625.912.06.31010165B750.30.615.412.37.81010165AnameCulture
methane(mmol)FinalMethane(T)Limonene(mmol)from:(T)Acetate(T)CysteinerecoMethane(%)***very

lbaT3.1:e
media.thethetoorinocula,thewithiedcarrsourcescarbonendogenousthetorelatedistoaddedacetateofacestrproducedmethanetheofuchmwohdewshol)(CtrculturesControl(2mM).acetateofacestrofabsenceorpresencetheinlimonenewithculturesichmentenrinproductionmethaneandconsumptionLimonene

3.2Degradationoflimoneneundermethanogenicconditions

Figure3.1:Limonenedegradationintwoenrichmentculturesincubatedinthepresence(filledsym-
bols)orabsence(openedsymbols)ofacetate(2mM)undermethanogenicconditions.
PanelAshowstheopticaldensityincreaseinthetwoenrichmentcultures,growing
with5%(filledcircle)and2%(openedcircles)limoneneinHMN.Thereisatransient
accumulationofacetateinenrichmentculturesincubatedonlywithlimonene(empty
squares).PanelBshowstheconsumptionoflimoneneinthesameenrichmentcul-
tures,with5%(filleddown-triangles)and2%(emptydown-triangles)limoneneinHMN
versusincubatedcontrolswithoutinocula(correspondingfilledandemptyup-triangles).
InpanelCisshownthemethaneproductioninenrichmentcultures(correspondingfilled
andemptyhexagons)versusaninoculatedcontrolwithacetate2mM(filleddiamonds).

Figure3.2:Modelofmicrobialinteractionsinmethanogenicenrichmentculturesthrivingon
limonene.AtleasttwogroupsofBacteria,primaryfermentersandsecondaryfer-
menters(syntrophs),areinvolvedinlimonenedegradationtoacetate,formate,hydro-
genandcarbondioxide.ThesesmallsubstratescouldbeusedbymethanogenicAr-
chaeawhichproducecarbondioxideandmethanegas.Acetatecouldbeaswellutilized
.homoacetogensyb

29

3Anaerobiclimonenedegradation:resultsanddiscussions
3.3Microbialcommunitycomposition

Fewstudiesshowedthebiodegradationofunsaturatedhydrocarbonsundermethanogenic
conditions(Schink,1985b,a;HarderandFoss,1999),andsolelyonemicroorganismwas
isolatedintheabsenceofalternativeelectronacceptors,theacetylenefermentingPelobac-
teracetylenicus(Schink,1985b,2006).Thescopeofthisstudywastoidentifyphyloge-
neticallywhatmicroorganismsplayaroleinlimonenedegradationanddeterminetheir
abundance.Forthispurpose,weusedthe16SrRNAapproach(Amannetal.,1995).
WeestablishedclonelibrariesforBacteriaandArchaea16SrRNAgenes.ARDRAanal-
ysiswasperformedon327Bacteriaclonesand141Archaeaclones.Therepresentative
clonesforeachARDRApatternweresequenced.Wepartiallysequenced141Archaea
clonesand130Bacteriaclones.Phylogeneticanalysiswereperformedwith34Bacteria
and28Archaearepresentative16SrRNAalmostfulllengthsequences.16SrRNAgene
sequenceswithmorethen98.5%identitywereregardedasoneOTUoronephylotype.
Thequantitativeanalysisoftheenrichmentcultures,wasdonebyCARD-FISH.Thisinsitu
hybridizationmethodwaspreferredtothemoreusualmono-labeledFISH,tosurpass:i)
lowercellmetabolicactivities;orii)differentcellwallcomposition,whichsuchacomplex
communitymighthave.
Employingthisculture-independentapproach,werevealedthepresenceofunusualphy-
lotypesspanningthroughthesuper-kingdomsofBacteriaandArchaea.Bacteria16SrRNA
genesequenceswererepresentedby11OTUs(Table2)relatedto:(i)Bacteroidetes,(ii)
Deltaproteobacteria,(iii)CandidateDivisionOP3andaswell(iv)Firmicutes(Figure3.3).
Archaea16SrRNAgenesequenceswererepresentedby10EuryarchaeotaOTUs,related
tomicroorganismsfromtheorders(v)Methanomicrobialesand(vi)Methanosarcinalles
3.4).(Figure(i)Bacteroidetes.FiveBacteroidetesOTUsshowed12%to16%sequenceidentity
differencestotheirnextculturedrelative,Prolixibacterbellariivorans.TheothertwoBac-
teroidetesOTUshad16%to18%differencefromtheirnextinculturerelative,Alistipes
putredinis.Allsevenphylotypesshowedlargedifferencesinbetweeneach-other(4%to
20%).GenusProlixibacterisrepresentedbyfacultativeanaerobes,whichfermentsugars
bymixed-acidfermentation(Holmesetal.,2007).WhereasgenusAlistipes,isrepresented
bystrictlyanaerobicmicroorganisms,whichthriveoncomplexsubstratesandhaveasmain
metabolicproduct,succinate(Rautioetal.,2003;Songetal.,2006).Consideringthelarge
phylogeneticdifferences,thephylotypesretrievedfromlimonenedegradingenrichments
likelybelongtonewgenera,withinfamilyRikenellaceae.
ABacteroidetesprobe,CF-319amatchedinsilicoallretrievedphylotypes.Howeverthis
probematchedonly1%oftheDAPIstainedcellsintheenrichmentcultures.Bacteroidetes
areusuallyinvolvedinbreakdownandfermentationofcomplexorganicmaterial,however
theirlownumbersduringmidexponentialgrowthcouldnotexplaintheturnoveroflimonene.
(ii)Deltaproteobacteria.TwoDeltaproteobacteriaOTUswereidentified,at10%dis-
tancefromeach-otherand8%distancefromthenon-syntrophicSyntrophobactersp.strain

30

compositionunitycommMicrobial3.3

TsuA1(Figure3.3).ThisSyntrophobacterstrainisasulfatereducerwhichgrowsonadi-
pateandisabletoutilizeC1-C12straightfattyacids,C2-C10straightchainprimaryalco-
hols,2-,3-hexadionate,pyruvate,andlactate(Tanakaetal.,2000).OurSyntrophobac-
ter-relatedphylotypes,wereonlyfarrelatedtothissulfate-reducer,andshowedevenlarger
differencestosyntrophicmicroorganismsofthefamilySyntrophobacteraceae.Thisimplies
thattheybelongtonovelgenerawithintheclassDeltaproteobacteria.Deltaproteobacteria,
includingSyntrophobacter-relatedmicroorganismsweretargetedbyprobeDelta-495aand
madeupfor13%oftheentiremicrobialpopulation.Mostlikelytheyplayanimportantrole
inthebreakdownfattyacidswhicharereleasedbyfermentingbacteria.

(iii)CandidateDivisionOP3.Interestingly,oneOTUrepresentedbyfivesequences,
wasveryfarfromanythingcultureduntilnow,with24.2%differencetothenearestincul-
turerelative,Opitussp.VeSm13,fromphylumVerucomicrobia.Thisphylotypeshowed
higher16SrRNAgeneidentity(16.7%different)tomembersoftheunculturedphylum
CandidateDivisionOP3.Anewlydesignedprobe,OP3-565,wasusedtotargetspecif-
icallyOP3-relatedmicroorganisms,andverysmallandroundshapedcells,foundeither
aloneorattachedtolargercellsthatwerenotOP3-related(Figure3.5),madeupfor18%
oftheentiremicrobialcommunity(Table10.4).Todoublecheckthepresenceandquantityof
CandidateDivisionOP3member,weusedprobePla-46,aPlanctomycetespecificprobe,
whichmatchedinsilicotheCandidateDivisionOP3phylotype.Whenapplied,thisprobe
stainedthesamemorphotypelikeOP3-565,accountingfor13%ofthetotaldetectedcells.

WithinCandidateDivisionOP3thereisnoisolateavailable,sotheirmetaboliccapabilities
areunknown.However,numerous16SrRNAsequencesofCandidateDivisionOP3were
recoveredsolelyfromanoxichabitatslike:i)anoxicsedimentsofYellowstoneHotSpring
(Hugenholtzetal.,1998),ii)anoxicwaterbodyofCariacobasin(Madridetal.,2001),
iii)groundwaterofagoldmine(Linetal.,2006)orofapristinecoastalaquifer(Lopez-
Archillaetal.,2007)andiv)deepsubsurfaceoftheAntarcticcontinentalshelf(Bowmanand
McCuaig,2003)etc.Besides,OP3sequenceswerefoundintwoanaerobicandmesophilic
chemostatsthrivingonpropionateorbutyrate(Shigematsuetal.,2006;Tangetal.,2007)
whichimpliesthatOP3membersareanaerobesthatmightbeinvolvedinshortchainfatty
adation.rdegacid

(iv)Firmicutes.OurBacteriaclonelibraryrevealedalsothepresenceofoneFirmicutes
phylotype.Thissequenceshowed96.3%similaritytoSyntrophomonascellicola,which
growssyntrophicallywithMethanobacteriumformiciumonC4toC9fattyacids(Wuetal.,
are2006).brokSen.docellicolawntodegrpropionateades.C-evGenenusfattyacidsSyntrophomonastoacetateisgenerwhereasallytheinvolvC-oddedinffattyattyacidsacid
degradationtoshorterfattyacids(SchinkandStams,2006).HenceSyntrophomonas-like
organismscouldplayanintermediateroleinlimonenedegradationbetweenthe„primary“
fermentersandthe„secondaryfermenters“-syntrophs.

31

3

adation:rdeglimoneneAnaerobic

3.3:Figure

32

Mumaximyparsimontreeofdiscussionsandresults

Bacteria16SrRNAgenesequencesretrviedefromlimonenerdegadingmethanogenicenrichmentcultures.TherepresentativeBacteriasequencesobtainedinthisstudyareempha-
sizedinboldletters.Theaccessionnumberofreferencesequencesisshowninparenthesis.Crenarchaeota
sequenceswereusedasout-group.Thescalebarcorrespondsto10substitutionsper100nucleotides.

compositionunitycommMicrobial3.3

(v)Methanomicrobiales.TwoArchaeaphylotypesrecoveredfromlimonenedegrading
enrichments,hadasclosestinculturerelative,Methanoculleuspalmolei(88%to92%)a
highlyirregularcocci,isolatedfromananaerobicbioreactortreatingwastewaterofapalm
oilmill(Zellneretal.,1998).M.palmolei,likemostmembersofgenusMethanoculleus,
hascomplexnutritionalrequirementssuchaspotassiumandtungstenionsasgrowthpro-
moters,oracetateasorganicmineralsupplement(Zellneretal.,1998;Whitmanetal.,
2006).Inlimonenedegradingenrichmentsintheabsenceofsupplementaryacetate,we
observedalongerperioduntilmethaneformationstarted.Methanewasformedlikelyafter
thebacterialcommunitybrokedownlimonenetoacetate.
(vi)Methanosarcinalles.TheorderMethanosarcinalleswasrepresentedby8OTUs
fromtheArchaeaclonelibrary,whichwereverysimilaroridenticaltothe16SrRNAgeneof
Methanosaetasp.strainAMPBZgandMethanosaetaconcilii.Methanosaetaconciliiwas
isolatedfromapearwastedigestor(PatelandSprott,1990)whereasMethanosaetasp.
AMPB-Zgwasisolatedfromfreshwatersediment(ScholtenandStams,2000).Bothwere
describedassheathedrodsthataggregateintobundles.Weidentifiedsuchfilamentswith
aMethanosaetaceaespecificprobe,MX-825,thattargetedinsilicoalltheMethanosaeta
phylotypesfromourArchaeaclonelibrary.However,duringinsituhybridizationexperi-
ments,MX-825stainedonly1%ofthetotalcellsfromalimonenedegradingenrichment.
ThisprobestainedMethanosaeta-likefilamentsheterogeneouslyasshowedinarecent
hybridizationstudyonM.concilii(Kubotaetal.,2008).GenusMethanosaetacomprises
obligateanaerobeswhichuseassoleenergysourceacetate,convertingitintoequimolar
amountsofmethaneandcarbondioxide.ThepresenceofMethanosaetainculturesin-
cubatedwithlimoneneintheabsenceofacetate,isanindirectproofforacetaterelease
duringlimonenedegradationundermethanogenicconditions.
Kingdomspecificprobing.TheEubacteriageneralprobe,Eub-338(I),matchedin
silicomostsequencesfromtheBacteriaclonelibrary,withtheexceptionofCandidateDivi-
sionOP3phylotype.ThisphylotypedidnotmatchinsilicoanyotherpublishedEubacteria
probes(Eub-338IIandIII).ThereforewedesignedanewEubacteriaprobe,Eub-338(VI),
whichperfectlypairedpositions338-355onthe16SrRNAgeneofCandidateDivisionOP3
sequences.Thesetwoprobeswhenappliedinequimolaramount,targeted40%fromthe
totalDAPIstainedcells.TheArchaeaprobe,Arch-915,matchedcellswithinMethanosaeta-
likefilamentsandrodswithflatends,makingupfor33%oftheentiremicrobialcommunity
detectedbyDAPI.AscontrolprobeprobeNon-338wasused,andgaveonesignalforeach
300DAPIstainedcells.Circa26%oftheDAPIstainedcellswerenotdetectedwithHRP-
labeledgeneralprobes(Figure10.4).ThereasoncouldbethatthegeneralArch-915did
nottargethomogeneouslytheMethanosaeta-likefilamentsbutratherscarcecellsthrough
thefilaments(Figure10.4CandD),henceunderestimatingtheabundanceoftheArchaea
population.Whenmono-labeledFISHwasapplied,theArchaeaabundancedidnotdiffer,
butthenOP3-phylotypescouldnotbedetected.
Thereasonswhykingdomspecificprobesaccountedonlyfor73%ofthetotalDAPI
stainedcells,couldbe:i)anunevenpermeabilizationtreatmentofthedifferentcelltypes

33

3Anaerobiclimonenedegradation:resultsanddiscussions
priortohybridization,ii)deadcellsoremptysheathstretcheswithinMethanosaetafila-
ments,andiii)theexistenceofotherunknownphylasinourenrichmentswhicharenot
targetedbyknownphylogeneticprobesandprimers.
Nevertheless,thesemethanogenicenrichmentsthrivingonlimonenedisplayedacom-
plexsyntrophiccommunityspreadthroughtheBacteriaandArchaeakingdoms.Limonene
ismostlikelydegradedbyBacteriatoacetate,andthenisfurtheronmetabolizedby
methanogenicArchaea,tomethaneandcarbondioxide.WeidentifiedunusualBacteria
phylotypes,whichcouldberepresentativesofnovelgenuswithinRickenelaceae,andSyn-
trophobacteraceae.WevisualizedandquantifiedmembersofthehithertounculturedCan-
didateDivisionOP3,whosesmallroundcellsoftenattachtothesurfaceofotherbacteria.

34

Figure3.4:MaximumparsimonytreeofArchaea16SrRNAgenesequencesretrievedfrom
limonenedegradingmethanogenicenrichmentcultures.TherepresentativeArchaea
sequencesobtainedinthisstudyareemphasizedinboldletters.Theaccessionnum-
berofreferencesequencesisshowninparenthesis.Crenarchaeotasequenceswere
usedasout-group.Thescalebarcorrespondsto10substitutionsper100nucleotides.

compositionunitycommMicrobial3.3

Table3.2:RelativeabundanceofdifferentgroupsofBacteriaandArchaea
inmethanogenicenrichmentculturesthrivingonlimoneneas
ybquantifiedCARD-FISH.

PROBETARGETKINGDOMSPECIFICGROUPSPECIFIC
(%)*(%)*Eub-338(I&VI)Eubacteria40-
0-NonsenseNon-338-33ArchaeaArch-915Delta-495aδ-Proteobacteria-12
-1BacteroidetesCF-319a**13-ycetesPlanctomPla-468-1OP3CandidateOP3-565-1MethanosaetaMX-825Totalrecovery-7332
*NumbersshowthepercentagesofcellsthathybridizedtoaprobeversusDAPI-stainedcellsinthesamevisual
field.**ThisprobewasusedtotargetCandidateDivisionOP3,sinceinsilicoitfullymatchedourOP3sequences.The
13%Pla-46targetedcellswereexcludedfromthetotalrecovery.

35

3Anaerobiclimonenedegradation:resultsanddiscussions

3.5:Figure

36

Microscopicimagesofsamplesfrommethanogenicenrichmentculturesthrivingon,limonenesavisualizedbyepifluorescencemicroscopy(A-F)andphasecontrastmicroscopy(GandH).Theleft
panelsrepresentsamplesstainedbydifferentHRPlabeledprobes.Theredsignalsaregivenbythe
HRPcatalyzeddepositionofAlexa-594tyramides.Totherightarethesamesamplesvisualizedby
aDNAstain,DAPI.PanelAshowscellsstainedbythegeneralEubacteriaprobes,Eub-338(Iand
VI).Thesamemicroscopicfieldisshowntotheleft,inpanelB,withcellsonlystainedbyDAPI.In
panelCareshownArch-915stainedcells.ThecorrespondingmicroscopicfieldvisualizedwithDAPI
isshowntotherigh,inpanelD.PanelE,depictscellsstainedwiththenewlydesignedprobe,OP3-
565,specificfortheCandidateDivisionOP3phylotypefromtheBacteriaclonelibrary.Totheright
isthesamemicroscopicfieldvisualizedbyDAPI.Thetwophasecontrastmicroscopicimages,show
anaggregate(panelG)andtheusualmorphotypes(panelH)encounteredinlimonenedegrading
enrichmentcultures.Thescalebaris5μmforallimages.

3.4IsolationofnovelDeltaproteobacteria
3.4IsolationofnovelDeltaproteobacteria

Syntrophicmicroorganismscapableoffattyacidandalcoholdegradationaredifficulttoiso-
late,becausetheydependonthemethanogenicpartnersfortheremovalofexcessreduc-
ingequivalents.Theuseofsuchsubstratesthataremoreoxidizedthentheinitialoneisa
welldescribedprocedureforisolationofsyntrophicmicroorganisms(Schink,1985a;Beaty
andMcInerney,1987;Wallrabensteinetal.,1994,1995a).Forabetterunderstandingof
therelationshipsestablishedbetweenmembersoflimonenedegradationenrichments,we
attemptedisolationofsyntrophicbacteria.Fumarateandlactatewereusedassubstrates
formicrobialgrowthunderfermentingconditions.Wepurifiedthestrainsbydilutionsin
.agarsolidYellow-whitecolonieswereobtainedusingtherolltubetechnique(Hungate,1969).We
selected40colonies,fortransferinfreshwatermethanogenicliquidmedia.Transferstook
morethen6monthsforgrowthandonly8coloniesdevelopedintostableliquidcultures.
Fromthese,threefermentedlactate(SynL-5-9-c1,SynL-5-9-c2andSynL-65)andtheother
fivefermentedfumarate(SynF-5-17-c1,SynF-5-17-c2,SynF-5-17-c3,SynF-5-18-c1).Lac-
tateisolatedstrainswererepresentedbylargevibrioshapedcellswithanaveragesizeof
0.9μm×2.5μm.Thefumarateisolatedstrainswerelesscurvedandslightlysmallerwith
anaveragesizeof0.8μm×2.4μm.
Thephylogeneticpositionwasdeterminedby16SrRNAsequenceanalysis(Figure3.6).
WeobtainedsequencesofeachisolateandcomparedthemusingtheARBsoftware.All
isolatesweretherepresentativesofasinglephylotypewithmorethen99%16SrRNA
geneidentitybetweeneachother.Theirclosestrelative(91.2%)wasasequenceretrieved
from4-methyl-benzoatedegradingmethanogenicenrichment(Wuetal.,2001).Theirclos-
estculturedrelative,wasDesulfoarculusbaarsii(11%difference),asulfatereducerthat
oxidizesformate,anddoesnotoxidizelactate(Widdel,1980,1981).Ourisolatesare
farrelatedtomembersofgenusSyntrophobacter,andeventhenearestneighbor,Syn-
trophobacterphennigii(Wallrabensteinetal.,1995b),showedonly85%16SrRNAgene
.identityTodetermineiftheseisolatesarerepresentedinlimonenedegradingenrichmentcul-
tures,DGGEwasperformedonisolatesandDNAextractedfromanenrichmentculture.
Theamplified16SrDNAgeneofallisolatesmigratedtothesamepositionindenaturing
gel(Figure3.7).Twoofthefumarateisolatesshowedasecondbandatahigherpositionon
thegel.Thiscouldbedueto:i)impurityofcultures,sodifferentDGGEpatternsemerged;
ii)eachstrainhastwodifferent16SrRNAoperons,whichcouldresultfromaninsertionor
ahigherG+Ccontentinoneofthe16Soperons.WesequencedthedominantDGGEband
thatwascommonforalltheisolatedstrains,andanalyzeditsrelationshipstothe16SrRNA
genesofisolatesandobserved100%identity(Figure3.7).Clonelibrariesdidnotprovide
informationonthisphylotype,howeveraweakbandwaspresentatthesamepositionwith
theisolates,inalimonenedegradingenrichmentculture,implyingthattheseorganismsare
presentinenrichmentcultures.

37

3Anaerobiclimonenedegradation:resultsanddiscussions

38

Figure3.6:Maximumparsimonyphylogenetictreeof16SrRNAgenesequencesof
microorganismsisolatedfromlimonenedegradingmethanogenicenrich-
mentcultures(gray).Theclosestrelatedclonesfromlimonenedegrading
enrichmentsareemphasizedingreen.ThetreewasrootedusingChlorobi
sequencesasanout-group.Thescalebarrepresents10substitutionsper
.bp100

Figure3.7:DGGEpatternsofnewlyisolatedstrainsandextracted16SrDNAofan
enrichmentthrivingonlimonene.Thefrontofthegelisnotshown.

outlookandConclusions3.5

Tounderstandthephysiologyofthesestrainstheirfermentationprofilewasanalyzed.
Threestrainsfermentedlactatetoacetate,andtracesofpropionateandbutyrate.Whereas
fumaratewasfermentedbyfourstrainstoacetateandsuccinate.Theclosestin-culturerel-
ativeatthephylogeneticlevelisincapabletoutilizelactateevenundersulfatereducing
conditions.Lactatefermentationtoacetatewasobservedforotherorganismsinpurecul-
ture(Pluggeetal.,2002)orco-culturewithahydrogenand/orformateutilizingmethanogen
(Wallrabensteinetal.,1995b).Growthofourisolatesinco-cultureswithanacetotrophic
andformate-hydrogenutilizingmethanogen,Methanosarcinamazei,inthepresenceof
limonenelikelyoccurredattheexpenseofsubstratescarriedwiththeinocula.Wesuggest
thatthesenewlyisolatedDeltaproteobacteriadonotplaytheroleofprimaryfermenters
inlimonenedegradation,butofsecondaryfermenters(syntrophs),likelybeinginvolvedin
shortchainfattyacidoralcoholdegradation.Abetterunderstandingofthephysiology
ofthesestrains,couldoffermoreinsightsonthemechanismoflimonenemethanogenic
adation.rdeg

outlookandlusionsConc3.5Ourresultsshowthatlimoneneisconvertedtomethaneandcarbondioxidebyamicro-
bialcommunityrepresentedbyfivephylas.Microbialcommunitiesliketheonestudied
here,maycontributetothedisappearanceofmonoterpenesfromburiedbiomassindeep
biosphere,undergroundwaters,deepseaventswherealkenedegradationsismostlyat-
tributedtogeochemicalprocesses(TissotandWelte,1984).Abetterunderstandingof
alkenedegradationundermethanogenicconditionscoulduncoverthesignificanceofmi-
crobialmediatedmonoterpenedegradationfordiagenesis.
DifferencesinBacterialcommunitiescouldbeseenbetweenmethanogenicenrichments
thrivingonthesaturatedaliphatichydrocarbon,hexadecane(Zengleretal.,1999)thearo-
matichydrocarbon,toluene(Fickeretal.,1999)andthealkenoicmonoterpene,limonene
(thisstudy).Thealkane(hexadecane)EubacterialcommunitywasrepresentedbySyntro-
phusandDesulfovibriophylotypes(Zengleretal.,1999).TheEubacterialcommunityinthe
monoaromatic(toluene)degradingenrichmentwasrepresentedmostlybyDesulfotomac-
ulum,andaphylotypewhichdidnotgroupwithanyknowngenus(Fickeretal.,1999).
Whereasinourenrichmentswhichdegradealkenoicmonoterpenes,wedeterminedthat
mostEubacteriaweremembersofSyntrophobacteraceaeandCandidateDivisionOP3.
Thiscouldbetheresultofverydifferentmicrobesinvolvedintheprimaryandsecondary
stepsofdegradationofalkanes,alkenesoraromatics.Unsurprisingly,themethanogenic
communitywasoverallsimilarinallthreeenrichments,regardlessoftheelectrondonor.
SimilarmetabolicendproductsarelikelyproducedbyEubacteria(acetate,formate,hy-
drogen)whicharefurtherutilizedbyacetotrophic(Methanosaeta)andhydrogenotrophic
(MethanoculleusandMethanospirillum)Archaea.
ForthefirsttimemembersofCandidateDivisionOP3werevisualizedandquantifiedin
thisstudy.Thesmallroundshapedcellsfoundinlimoneneenrichmentsassinglecells

39

3Anaerobiclimonenedegradation:resultsanddiscussions

orclusteredaroundotherlargercellshaveunknownfunction.Monitoringthevariationin
OP3-likecellsduringdifferentgrowthstagesoftheculture,couldprovideinformationon
therighttimefordifferentseparationapproaches:i)filtration,ii)flow-cytometryandiii)
Percolgradient.Thefractionwherethesecellsdominatecouldbeusedformetagenomic
studies,whichcouldprovideinsightsintotheirgeneticpotential.Theinferredfunctions
frommetagenomicstudiescouldbethegroundbasisforestablishingdifferentisolation
.ategiesstrIsolationoflactateandfumaratefermentingDeltaproteobacteriafromlimonenedegrad-
ingenrichments,revealedtheexistenceofadifferentDeltaproteobacteriaphylotypecom-
paredtotheDeltaproteobacteriaphylotypesuncoveredbythemolecularapproach.These
microorganismsmightbeinvolvedinthedegradationofshortchainfattyacids,andalco-
hols,playingtheroleof„secondaryfermenters“or„syntrophs“.Hencethecombination
ofcultivation-dependentandcultivation-independentmethods,helpedtobetterunderstand
thecompositionandpossiblefunctioningoflimonenedegradingenrichmentcultures.
Wesuggestfurthercultivationattemptsof„primaryfermenting“microorganismsbyutiliz-
inglargefattyacidsoralcohols(e.g.geraniol),inthepresenceorabsenceofanelectron
acceptor(sulfate).Thefattyacidsoralcoholstobeusedcouldbepotentialimmediateprod-
uctsoflimonenehydrolysis,orproductsexpectedtobenextinthedegradationpathway.
Growthonlimoneneundersulfatereducingconditions,couldbefollowedbyisolationof
microorganisms,approachthatcouldrevealtheidentityoflimonenedegradingmicroorgan-
ismsfromenrichments.Afterward,theirabilitytodegradelimonenecouldbedemonstrated
inco-cultureexperimentswith„primaryfermenting“microorganismandthereadilyisolated
„secondaryfermenting“Deltaproteobacteriagrownonlimoneneundermethanogeniccon-
ditions.Moreover,purificationofmethanogenicArchaeacouldbeattemptedwithhydrogen
andcarbondioxide,formateoracetateaselectrondonors.Thiswouldprovidethebasisfor
tri-cultureexperiments,witha„primaryfermenting“,„secondaryfermenting“andaspecific
methanogenicArchaeametabolictype.Aculture-dependentapproachcouldanswersome
ofthe„Howmanymetabolic-typesareneededtodegradelimonene?“;„Howfastisitdone
withoutothercompetingmicroorganisms?“;and„Whichstepisthelimitingone?“.

40

erencesRef4

Aeckersberg,F.,Bak,F.,andWiddel,F.(1991).Anaerobicoxidationofsaturatedhydrocar-
bonstoCO2byanewtypeofsulfate-reducingbacterium.Arch.Microbiol.,156:5–14.
Aeckersberg,F.,Reiney,F.,andWiddel,F.(1998).Growth,naturalrelationships,cellular
fattyacidsandmetabolicadaptationsofsulfatereducingbacteriathatutilizelong-chain
alkanesunderanoxicconditions.Arch.Microbiol.,170:361–369.
Ahring,B.andWestermann,P.(1987).Thermophilicanaerobicdegradationofbutyrate
byabutyrate-utilizingbacteriumincocultureandtriculturewithmethanogenicbacteria.
Appl.Environ.Microbiol.,53(2):429–433.
Amann,R.,Ludwig,W.,andSchleifer,K.(1995).Phylogeneticidentificationandinsitu
detectionofindividualmicrobialcellswithoutcultivation.Microbiol.Molec.Biol.Rev.,
59(1):143–169.Anderson,R.andLovely,D.(2000).Hexadecanedecaybymethanogenesis.Nature,
404:722–723.Birch,L.andBachofen,R.(1988).Microbialproductionofhydrocarbons.InRehm,H.,
editor,Biotechnology,volume6b,pages71–99.VerlagChemie,Weinheim.
Bonin,P.,Cravo-Laureau,C.,andHirschler-Rea,A.(2004).Theanaerobichydrocarbon
biodegradingbacteria:anoverview.Ophelia,58:243–254.
Bowman,J.andMcCuaig,R.(2003).Diversityandbiogeographyofprokaryotesdwelling
inAntarcticcontinentalshelfsediment.Appl.Environ.Microbiol.,69:2463–2484.
Bregnard,T.-A.,Haener,A.,andHoehener,P.(1997).Anaerobicdegradationofpris-
taneinnitrate-reducingmicrocosmsandenrichmentcultures.Appl.Environ.Microbiol.,
63(5):2077–2081.Callaghan,A.,Gieg,L.,Kropp,K.,Suflita,J.,andYoung,L.(2006).Comparisonofmech-
anismsofalkanemetabolismundersulfatereducingconditionsamongtwobacterialiso-
latesandabacterialconsortia.Appl.Environ.Microbiol.,71:4274–4282.
Cheesbrough,T.andKolattukudy,P.(1984).Alkanebiosynthesisbydecabonylationof
aldehydescatalyzedbyaparticulatepreparationfromPisumsativum.Proc.Nat.Acad.
81:6613–6617.,Sci.

41

erencesRef4Cravo-Laureau,C.,Labat,C.,Joulian,C.,Matheron,R.,andHirschler-Rea,A.(2007).
Desulfatiferulaolefinivoransgen.nov.,sp.nov.,along-chainn-alkene-degrading,sulfate-
reducingbacterium.Int.J.Syst.Evol.Microbiol.,57(11):2699.
Cravo-Laureau,C.,Matheron,R.,Cayol,J.-L.,Joulian,C.,andHirschler-Rea,A.(2004a).
Desulfatibacillumaliphaticivoransgen.nov.,sp.nov.,andn-alkaneandn-alkenedegrad-
ing,sulfate-reducingbacterium.Int.J.Syst.Evol.Microbiol.,54:77–83.
Cravo-Laureau,C.,Matheron,R.,Joulian,C.,Cayol,J.,andHirschler-Rea,A.(2004b).
Desulfatibacillumalkenivoranssp.nov.,anoveln-alkene-degrading,sulfate-reducing
bacterium,andemendeddescriptionofthegenusDesulfatibacillum.Int.J.Syst.Evol.
54(5):1639–1642.,Mirobiol.Curiale,J.andFrolov,E.(1998).Occurrenceandoriginofolefinsincrudeoils.Acritical
review.Org.Geochem.,29(1-3):397–408.
Davidova,I.,Duncan,K.,Choi,O.,andSuflita,J.(2006).Desulfoglaebaalkanexedens
gen.nov.,sp.nov.,ann-alkane-degrading,sulfate-reducingbacterium.Int.J.Syst.Evol.
56:2737–2742.,Microbiol.Ehrenreich,P.,Behrends,A.,Harder,J.,andWiddel,F.(2000).Anaerobicoxidationof
alkanesbynewlyisolateddenitrifyingbacteria.Arch.Microbiol.,173:58–64.
Einsle,O.,Niessen,H.,Abt,D.,Seiffert,G.,Schink,B.,Huber,R.,Messerschmidt,A.,
andKroneck,P.(2005).CrystallizationandpreliminaryX-rayanalysisofthetungsten-
dependentacetylenehydratasefromPelobacteracetylenicus.Space,61(3):2.
Foss,S.andHarder,J.(1998).Thaueralinaloolentissp.nov.andThaueraterpenicasp.
nov.,isolatedonoxygen-containingmonoterpenes(linalool,menthol,andeucalyptol)and
nitrate.Syst.Appl.Microbiol.,21(3):365–373.
Foss,S.,Heyen,U.,andHarder,J.(1998).Alcaligenesdefragranssp.nov.,descriptionof
fourstrainsisolatedonalkenoicmonoterpenes((+)-menthene,α-pinene,2-carene,and
α-phellandrene)andnitrate.Syst.Appl.Microbiol.,21(2):237–44.
Fukuzaki,S.,Nishio,N.,Shobayashi,M.,andNagai,S.(1990).Inhibitionofthefermen-
tationofpropionatetomethanebyhydrogen,acetate,andpropionate.Appl.Environ.
56(3):719–723.,Microbiol.Grossi,V.,Cravo-Laureau,C.,Guyoneaud,R.,Ranchou-Peyruse,A.,andHirschler-Rea,
A.(2008).Metabolismofn-alkanesandn-alkenesbyanaerobicbacteria:Asummary.
39(8):1197–1203.,Geochem.Org.Grossi,V.,Cravo-Laureau,C.,Meou,A.,Raphel,D.,Garzino,F.,andHirschler-Rea,
A.(2007).Anaerobic1-alkenemetabolismbythealkane-andalkene-degradingsul-
fatereducerDesulfatibacillumaliphaticivoransstrainCV2803.Appl.Environ.Microbiol.,
73(24):7882–7890.

42

Grundmann,O.,Behrends,A.,Rabus,R.,Amann,J.,Halder,T.,Heider,J.,andWiddel,F.
(2008).Genesencodingthecandidateenzymeforanaerobicactivationofn-alkanesin
thedenitrifyingbacteriumstrainHxN1.Environ.Microbiol.,10:376–385.
Harder,J.andFoss,S.(1999).Anaerobicformationofthearomatichydrocarbonp-cymene
frommonoterpenesbymethanogenicenrichmentcultures.Geomicrobiol.J.,16(4):295–
305.Heyen,U.andHarder,J.(1998).Cometabolicisoterpinoleneformationfromisolimonene
bydenitrifyingAlcaligenesdefragrans.FEMSMicrobiol.Lett.,169(1):67–71.
Heyen,U.andHarder,J.(2000).Geranicacidformation,aninitialreactionofanaerobic
monoterpenemetabolismindenitrifyingAlcaligenesdefragrans.Appl.Environ.Micro-
66(7):3004–3009.,biol.Holmes,D.,Nevin,K.,Woodard,T.,Peacock,A.,andLovley,D.(2007).Prolixibacterbellari-
ivoransgen.nov.,sp.nov.,asugar-fermenting,psychrotolerantanaerobeofthephylum
Bacteroidetes,isolatedfromamarine-sedimentfuelcell.Int.J.Syst.Evol.Microbiol.,
57(4):701.Hugenholtz,P.,Pitulle,C.,Hershberger,K.,andPace,N.(1998).Noveldivisionlevel
bacterialdiversityinaYellowstonehotspring.J.Bacteriol.,180(2):366–376.
Hylemon,P.andHarder,J.(1999).Biotransformationofmonoterpenes,bileacids,and
otherisoprenoidsinanaerobicecosystems.FEMSMicrobiol.Rev.,22(5):475–488.
Kampfer,P.,Denger,K.,Cook,A.,Lee,S.,Jackel,U.,Denner,E.,andBusse,H.(2006).
Castellaniellagen.nov.,toaccommodatethephylogeneticlineageofAlcaligenesdefra-
grans,andproposalofCastellanielladefragransgen.nov.,comb.nov.andCastellaniella
denitrificanssp.nov.Int.J.Syst.Evol.Microbiol.,56(4):815–819.
Kesselmeier,J.andStaudt,M.(1999).Biogenicvolatileorganiccompounds(VOC):an
overviewonemission,physiologyandecology.J.Atmosph.Chem.,33(1):23–88.
Kniemeyer,O.,Musat,F.,Sievert,S.M.,Knittel,K.,Wilkes,H.,Blumenberg,M.,Michaelis,
W.,Classen,A.,Bolm,C.,Joye,S.B.,andWiddel,F.(2007).Anaerobicoxidationof
short-chainhydrocarbonsbymarinesulphate-reducingbacteria.Nature,449(7164):898–
U10.Kropp,K.,Davidova,I.,andSuflita,J.(2000).Anaerobicoxidationofn-dodecanebyan
additionreactioninasulfatereducingbacterialenrichmentculture.Appl.Environ.Micro-
66:5393–5398.,biol.Kubota,K.,Imachi,H.,Kawakami,S.,Nakamura,K.,Harada,H.,andOhashi,A.(2008).
EvaluationofenzymaticcelltreatmentsforapplicationofCARD-FISHtomethanogens.
J.Microbiol.Meth.,72(1):54–59.

43

erencesRef4

Lin,L.,Hall,J.,Onstott,T.,Gihring,T.,Lollar,B.,Boice,E.,Pratt,L.,Lippmann-Pipke,
J.,andBellamy,R.(2006).Planktonicmicrobialcommunitiesassociatedwithfracture-
derivedgroundwaterinadeepgoldmineofSouthAfrica.Geomicrobiol.J.,23(6):475–
497.Lopez-Archilla,A.,Moreira,D.,Velasco,S.,andLopez-Garcia,P.(2007).Archaealand
BacterialcommunitycompositionofapristinecoastalaquiferinDonanaNationalPark,
Spain.Aquat.Microb.Ecol.,47(2):123.
Madrid,V.,Taylor,G.,Scranton,M.,andChistoserdov,A.(2001).Phylogeneticdiversity
ofBacterialandArchaealcommunitiesintheanoxiczoneoftheCariacobasin.Appl.
67(4):1663–1674.,Microbiol.viron.EnMeckenstock,R.,Krieger,R.,Ensign,S.,Kroneck,P.,andSchink,B.(1999).Molecularand
spectroscopicpropertiesofthetungsteniron-sulfurenzyme.EurJBiochem,264(1):176–
182.Oremland,R.andVoytek,M.(2008).Acetyleneasfastfood:implicationsfordevelopment
oflifeonanoxicprimordialEarthandintheouterSolarSystem.Astrobiology,8(1):45–58.
Page,M.,Nelson,L.,Blomquist,G.,andSeybold,S.(1997).Cuticularhydrocarbonsas
chemotaxonomiccharactersofpineengraverbeetles(Ipsspp.)inthegrandicollissub-
genericgroup.J.Chem.Ecol.,23(4):1053–1099.
Patel,G.andSprott,G.(1990).Methanosaetaconciliigen.nov.,sp.nov.("Methanothrix
concilii")andMethanosaetathermoacetophilanom.rev.,comb.nov.Int.J.Syst.Evol.
40(1):79.,Microbiol.Rabus,R.,Wilkes,A.,Schramm,A.,Harms,G.,Behrends,A.,Amann,R.,andWiddel,F.
(2001).Anaerobicinitialreactionsofn-alkanes:evidencefor(1-methylpentyl)succinate
asinitialproductandforinvolvmentofanorganicradicalinthemetabolismofn-hexane
inadenitrifyingbacterium.J.Bacteriol.,183:1707–1715.
Rautio,M.,Eerola,E.,Väisänen-Tunkelrott,M.,Molitoris,D.,Lawson,P.,Collins,M.,and
Jousimies-Somer,H.(2003).ReclassificationofBacteroidesputredinisinanewgenus
Alistipesgen.nov.,asAlistipesputrediniscomb.nov.,anddescriptionofAlistipesfine-
goldiisp.nov.,fromhumansources.Syst.Appl.Microbiol.,26(2):182–188.
Rios-Hernandez,L.,Gieg,L.,andSuflita,J.(2001).Biodegradationofanalicyclichydro-
carbonbyasulfate-reducingenrichmentfromagascondensate-contaminatedaquifer.
Appl.Environ.Microbiol.,69(1):434–443.
Rontani,J.,Mouzdahir,A.,Michotey,V.,andBonin,P.(2002).Aerobicandanaerobic
metabolismofsqualenebyadenitrifyingbacteriumisolatedfrommarinesediment.Arch.
178(4):279–287.,Microbiol.

44

Rueter,P.,Rabus,R.,Wilkes,H.,Aeckersberg,F.,Reiney,F.,Jannasch,H.,andWiddel,F.
(1994).Anaerobicoxidationofhydrocarbonsincrudeoilbynewtypesofsulfate-reducing
372:455–458.,Natureia.bacterSavithiry,N.,Cheong,T.,andOriel,P.(1997).Productionofα-terpineolfromEscherichia
colicellsexpressingthermostablelimonenehydratase.Appl.Biochem.Biotechnol.,
63(1):213–220.Schink,B.(1985a).Degradationofunsaturatedhydrocarbonsbymethanogenicenrichment
cultures.FEMSMicrobiol.Lett.,31(2):69–77.
Schink,B.(1985b).Fermentationofacetylenebyanobligateanaerobe,Pelobacter
acetylenicussp.nov.Arch.Microbiol.,142(3):295–301.
Schink,B.(2006).ThegenusPelobacter.InDworkin,M.,Falkow,S.,Rosenberg,E.,
Schleifer,K.H.,andStackebrandt,E.,editors,TheProkaryotes,volume7,chapter3.4.1,
pages5–11.Springer-Verlag,New-York.
Schink,B.andStams,A.(2006).Syntrophyamongprokaryotes.InDworkin,M.,Falkow,
S.,Rosenberg,E.,Schleifer,K.H.,andStackebrandt,E.,editors,TheProkaryotes,vol-
ume2,chapter1.11,pages309–335.Springer-Verlag,New-York.
Scholten,J.andStams,A.(2000).Isolationandcharacterizationofacetate-utilizinganaer-
obesfromafreshwatersediment.Microb.Ecol.,40(4):292–299.
Seiffert,G.,Ullmann,G.,Messerschmidt,A.,Schink,B.,Kroneck,P.,andEinsle,O.(2007).
Structureofthenon-redox-activetungsten/[4Fe:4S]enzymeacetylenehydratase.Pro-
ceedingsoftheNationalAcademyofSciences,104(9):3073.
Shigematsu,T.,Era,S.,Mizuno,Y.,Ninomiya,K.,Kamegawa,Y.,Morimura,S.,andKida,
K.(2006).Microbialcommunityofamesophilicpropionate-degradingmethanogeniccon-
sortiuminchemostatcultivationanalyzedbasedon16SrRNAandacetatekinasegenes.
72(2):401–415.,Biotechnol.Microbiol.Appl.Singer,A.,Crowley,D.,andThompson,I.(2003).Secondaryplantmetabolitesinphytore-
mediationandbiotransformation.TrendsBiotechnol.,21(3):123–130.
So,C.,Phelps,C.,andYoung,L.(2003).Anaerobictransformationofalkanestofattyacids
byasulfate-reducingbacterium,strainHxd3.Appl.Environ.Microbiol.,69:3892–3900.
So,C.andYoung,L.(1999).Isolationandcharacterizationofasulfate-reducingbacterium
thatanaerobicallydegradesalkanes.Appl.Environ.Microbiol.,65(7):2969–2976.
Song,Y.,Kononen,E.,Rautio,M.,Liu,C.,Bryk,A.,Eerola,E.,andFinegold,S.(2006).
Alistipesonderdonkiisp.nov.andAlistipesshahiisp.nov.,ofhumanorigin.Int.J.Syst.
56(8):1985.,Microbiol.ol.Ev

45

erencesRef4

Spormann,A.M.andWiddel,F.(2000).Metabolismofalkylbenzenes,alkanes,andother
hydrocarbonsinanaerobicbacteria.Biodegradation,11(2-3):85–105.
Stams,A.,deBok,F.,Plugge,C.,vanEekert,M.,Dolfing,J.,andSchraa,G.(2006).
Exocellularelectrontransferinanaerobicmicrobialcommunities.EnvironmentalMicro-
8(3):371–382.,biologyTanaka,K.,Stackebrandt,E.,Tohyama,S.,andEguchi,T.(2000).Desulfovirgaadipica
gen.nov.,sp.nov.,anadipate-degrading,Gram-negative,sulfate-reducingbacterium.
Int.J.Syst.Evol.Microbiol.,50(2):639–644.
Tang,Y.,Shigematsu,T.,Morimura,S.,andKida,K.(2007).Effectofdilutionrateonthe
microbialstructureofamesophilicbutyrate-degradingmethanogeniccommunityduring
continuouscultivation.Appl.Microbiol.Biotechnol.,75(2):451–465.
Tissot,B.andWelte,D.(1984).Geochemicalfossilsandtheirsignificanceinpetroleumfor-
mation.InPetroleumformationandoccurrence,pages93–130.Springer-Verlag,Berlin-
Heidelberg,Germany,Berlin,2edition.
Ulrich,A.andEdwards,E.(2003).Physiologicalandmolecularcharacterizationofanaer-
obicbenzene-degradingmixedcultures.Environ.Microbiol.,5(2):92.
Warikoo,V.,McInerney,M.,Robinson,J.,andSuflita,J.(1996).Interspeciesacetate
transferinfluencestheextentofanaerobicbenzoatedegradationbysyntrophicconsortia.
Appl.Environ.Microbiol.,62(1):26–32.
Wentzel,A.,Ellingsen,T.,Kotlar,H.-K.,Zotchev,S.,andThrone-Holst,M.(2007).Bacterial
metabolismoflong-chainn-alkanes.Appl.Microbiol.Biotechnol.,76:1209–1221.
Whitman,W.,Bowen,T.,andBoone,D.(2006).Themethanogenicbacteria.InDworkin,M.,
Falkow,S.,Rosenberg,E.,Schleifer,K.H.,andStackebrandt,E.,editors,TheProkary-
otes,volume3,chapter9,pages165–207.Springer-Verlag.
Widdel,F.,Botius,A.,andRabus,R.(2006).Anaerobicbiodegradationofhydrocarbons
includingmethane.InDworkin,M.,Falkow,S.,Rosenberg,E.,Schleifer,K.H.,and
Stackebrandt,E.,editors,TheProkaryotes,volume2,chapter1.33,pages1028–1049.
Springer-Verlag,New-York.
Widdel,F.andRabus,R.(2001).Anaerobicbiodegradationofsaturatedandaromatic
hydrocarbons.Curr.Opin.Biotechnol.,12(3):259–276.
Wu,C.,Liu,X.,andDong,X.(2006).Syntrophomonaserectasubsp.sporosyntropha
subsp.nov.,aspore-formingbacteriumthatdegradesshortchainfattyacidsinco-culture
withmethanogens.Syst.Appl.Microbiol.,29(6):457–462.
Zellner,G.,Messner,P.,Winter,J.,andStackebrandt,E.(1998).Methanoculleuspal-
moleisp.nov.,anirregularlycoccoidmethanogenfromananaerobicdigestertreating

46

wastewaterofapalmoilplantinnorth-Sumatra,Indonesia.

48(4):1111–1117.

Zengler,K.,Richnow,

Methanemationrof

401(6750):266–269.

H.H.,Rossello-Mora,R.,Michaelis,

from

long-chain

alkanes

yb

Int..JSyst.ol.EvMicrobiol.W.,andWiddel,F.

anaerobic

microorganisms.

(1999).

,

,Nature

47

4

erencesRef

48

obicAnaer

trPa

II

omaticar

ydrhocarbon

degradation

49

5Monoaromatichydrocarbon
degradation

Allaromatichydrocarbonshaveascommonstructuralunitthebenzenering,whichhassix
carbonatomsconnectedbysimpleσ-boundsandnon-localizeddoublebonds,thatform
asharedπ-electroncloud.Thisexplainsthestabilityofthearomaticringstructure,which
becomesmorelabileattheadditionofsidechains.
Alikesaturatedaliphatichydrocarbons,aromatichydrocarbonsareformedbylong-term
geochemicalreactionsofburiedbiomass(TissotandWelte,1984)orbyplantsandin-
sects,wheretheyfunctionassecondarymetabolites.However,petroleumandfossilfuels
arethemainnaturalsourceofaromatichydrocarbonsintheenvironment.Themosttoxic
andsolublefractionofpetroleumconsistsofbenzene,toluene,ethylbenzene,andxylenes
(BTEX).Ourindustrializedworldproduceslargeamountsofsuchmonoaromatichydro-
carbons,e.g.565×103tonesalkylbenzenes(Associationofpetrochemicalsproducersin
Europe,A.P.P.E.)areproducedannuallyfromcrudeoil.Theextensiveuseofaromatichy-
drocarbonsinindustryledtoincreasedaccidentalaccumulationwhichisdisruptiveformost
lifeformsinthecontaminatedenvironments(ExxonValdezOilSpillTrusteeCouncil,2009).
Bioremediationofoilcontaminatedareas,providedevidencethatmostofthesehydrocar-
bonscouldberemovedbyaerobicprocesseswhereasanaerobichydrocarbondegradation
was„negligible“(Atlas,1981).Laterithasbeenattestedthatextensiveanaerobiczones
developwhensoilsandsedimentsarecontaminatedwithhydrocarbons(Chakrabortyand
Coates,2004).Ontheotherhand,themostsolubleoilfraction,BTEX(ShiuandMa,2000),
couldeasilygettransportedfromalocalizedspillarea,penetratingdeepsedimentlayers
andprotrudinginundergroundwaterswhereoxygenislessavailable.
Initialobservationsonanaerobicaromatichydrocarbondegradationwerelimitedtoen-
richmentculturesandinsituexperiments(fewexamplesKuhnetal.,1985;Grbìc-Galìcand
Vogel,1987;Kuhnetal.,1988;EdwardsandGrbic-Galic,1994;BallandReinhard,1996).
Presently,anaerobicmicroorganismscapableofanaerobicaromatichydrocarbondegra-
dationhavebeenisolatedandcharacterized(seeTable5.1).Ingeneral,thesourcesof
isolationforanaerobicalkylbenzenedegraders,varyfromcontaminatedtouncontaminated
sites(seeFriesetal.,1994).Furtherstudiesonpurecultureshelpedelucidatingpathways
andgenesthatencodeforkeyenzymesincatabolism.

51

5Monoaromatichydrocarbondegradation

52

Table5.1:Isolatedmicroorganismscapableofanaerobicdegradationofbenzene(Bz),toluene(Tol),
ethylbenzene(Eb),o-(oX)andm-xylene(mX).Someofthestrainsarecapableofuti-
lizingmorethenonehydrocarbon,howeverthisisnotlistedforsimplicitypurposes.Fur-
thermore,thelistcomprisesphylotypesretrievedfrommethanogenicorotherTEAen-
richments,withspecialemphasisonbenzenewereonlyfewpureculturesareavailable.

PHYLUMORGANISM(STRAIN/RELATIVE)H
β-ProteobacteriaAlicycliphylusdenitrificans(BC)
β-ProteobacteriaDechloromonasaromatica(RCBandJJ)
β-ProteobacteriaAzoarcussp.strainsDN11andAN09
β-ProteobacteriaCloneCartN1(Sterolibacterium)
δ-ProteobacteriaCloneBznS295(Desulfobacteriumanilini)
δ-ProteobacteriaCloneOR-M1(Desulfosporosinus)andOR-M2(D.anilini)
α-ProteobacteriaBlastochlosissulfoviridis(ToP1)
β-ProteobacteriaThaueraaromatica(T1)
β-ProteobacteriaThaueraaromatica(K172)
β-ProteobacteriaAzoarcussp.(T)
β-ProteobacteriaAzoarcustolulyticus(Tol-4,Td-1,2,15)
β-ProteobacteriaAzoarcustoluvorans(Td-17andTd-21)
β-ProteobacteriaAzoarcussp.(ToN1)
β-ProteobacteriaAzoarcussp.(T2,T4,T6,T10)
β-ProteobacteriaAzoarcustoluclasticus(MF7,MF23,MF63T,MF441)
α-ProteobacteriaMagnetospirillumsp.(TS-6,BM-1232,PM-1331and2411)
δ-ProteobacteriaGeobactermetallireducens(GS-15)
δ-ProteobacteriaGeobactergrbiciae(TACP-2TandTACP-5)
δ-ProteobacteriaDesulfobaculatoluolica(Tol2)
δ-ProteobacteriaStrainTRM1
δ-ProteobacteriaStrainPRTOL1
FirmicutesCloneEub-1(Desulfotomaculum)
Eub-1ClonewnUnknoβ-ProteobacteriaAromatoleumaromaticum(EbN1)
β-ProteobacteriaAzoarcussp.(EB1)
δ-ProteobacteriaStrainEbS7
δ-ProteobacteriaDesulfosarcinaovata(oXyS1)
FirmicutesDesulfotomaculumsp.(OX39)
β-ProteobacteriaAzoarcussp.(mXyN1)
β-ProteobacteriaAzoarcussp.(M3-M7,M9,M12)
δ-ProteobacteriaStrainmXyS1
FirmicutesDesulfotomaculumsp.(OX39)
δ-ProteobacteriaDGGEband(D.ovataoXyS1)

CELECTRONREFERENCE
ORCEPTCABzChlorate(Weelinketal.,2008)
BzNitrate(Coatesetal.,2001)
BzNitrate(Kasaietal.,2006)
BzNitrate(UlrichandEdwards,2003)
Bzsulfate(MusatandWiddel,2007)
BzBicarbonate(UlrichandEdwards,2003)
TolAnox.phototr.(Zengleretal.,1999)
TolNitrate(Evansetal.,1991)
TolNitrate(Andersetal.,1995)
TolNitrate(Dolfingetal.,1990)
TolNitrate(Friesetal.,1994;Zhouetal.,1995)
TolNitrate(Friesetal.,1994)
TolNitrate(RabusandWiddel,1995)
TolNitrate(Hessetal.,1997)
TolNitrate(Songetal.,1999)
TolNitrate(Shinodaetal.,2005)
TolIron(LovleyandLonergan,1990)
TolIron(Coatesetal.,2001a)
Tolsulfate(Rabusetal.,1993)
Tolsulfate(Meckenstock,1999)
Tolsulfate(Belleretal.,1996)
TolBicarbonate(Fickeretal.,1999)
TolBicarbonate(Fickeretal.,1999)
EbNitrate(RabusandWiddel,1995)
EbNitrate(Balletal.,1996)
Ebsulfate(Kniemeyeretal.,2003)
oXsulfate(Harmsetal.,1999;Kueveretal.,2005)
oXsulfate(Moraschetal.,2004)
mXNitrate(RabusandWiddel,1995)
mXNitrate(Hessetal.,1997)
mXsulfate(Harmsetal.,1999)
mXsulfate(Moraschetal.,2004)
pXsulfate(Nakagawaetal.,2008)

yenylogPhThemajorityofdescribedanaerobicBTEXdegradersgroupwithinphylumProteobacteria
(Table5.1),togetherwithotheralkylbenzenedegraders(e.gpCyN1and2,orPbN1)(Rabus
andWiddel,1995b;Harmsetal.,1999a;WiddelandRabus,2001;Widdeletal.,2006)and
withaliphatichydrocarbondegraders(seeChapter1and2).
Nitrateandchloratereducing.Mostnitrateandchloraterespiringaromaticdegraders
(Table5.1)areBetaproteobacteria,fromthegeneraAzoarcus(Dolfingetal.,1990;Fries
etal.,1994;RabusandWiddel,1995;Balletal.,1996;Hessetal.,1997;Songetal.,1999;
Kasaietal.,2006),Thauera(Evansetal.,1991;Andersetal.,1995)andDechloromonas
(Coatesetal.,2001).CellhybridizationexperimentsconfirmedthatBetaproteobacteria
predominateindieselfuelcontaminatedlaboratoryaquifercolumns(Hessetal.,1997),
whereastheAzoarcus-Thaueragrouppredominateindenitrifyingenrichmentculturesgrown
oncrudeoil(Rabusetal.,1999).Otheranaerobicaromaticdegradershavebeenisolated
suchasthebenzenedegrading,AlicycliphylusdenitrificansstrainBC(Weelinketal.,2008)
whichrespireschlorate;adenitrifyingtoluenedegradingAlphaproteobacteriafromgenus
Magnetospirillum(Shinodaetal.,2005).Whereasinanenrichmentgrownunderdenitri-
fyingconditionswithbenzene,Sterolibacterium-relatedmicroorganismsdominate(Ulrich
andEdwards,2003).Thus,aromatichydrocarbondegradationundernitrateandperchlo-
ratereducingconditionsseemsnottoberestrictedtothewelldescribedAzoarcus-Thauera
andDechloromonasgenera.Itisofimportancetomentionthatperchloratecouldrelease
oxygen,hencethedegradationofBTEXunderperchloratereducingconditionsshouldnot
beconsideredasanusualanaerobicprocess.
Iron(III)reducing.Theonlydescribediron(III)-reducingorganismscapableoftoluene
utilizationbelongtogenusGeobacter(LovleyandLonergan,1990;Lovleyetal.,1993;
Coatesetal.,2001a).Moreover,Geobacteraceaephylotypeswerefoundiniron(III)-
reducingenrichmentculturesgrowonbenzene,tolueneandxylenes(BottonandParsons,
2007).ThesamestudyprovidedbssAphylogenydatawhichsuggestthatanAzoarcus-
Thauera-relatedmicroorganismmightplaytheroleofahydrocarbonutilizer.Andthey
proposedasyntrophiccooperationbetweeniron(III)-reducingmicroorganismsandthehy-
drocarbondegraders(BottonandParsons,2007).
Sulfatereducing.AlmostallSRBcapableofmonoaromatichydrocarbondegrada-
tionbelongtoDeltaproteobacteriawithingenusDesulfobaculaandDesulfosarcina.Afew
strainsformacladeofhydrocarbondegradingDeltaproteobacteriawhichincludesstrains
capableofm-xylene(Harmsetal.,1999),ethylbenzene(Kniemeyeretal.,2003)andnaph-
thalenedegradation(Galushkoetal.,1999).Inenrichmentculturescapableofbenzene
degradation,thedominantmemberswererelatedtothiscladeofaromatichydrocarbonde-
gradersandtoDesulfobacteriumanilini(MusatandWiddel,2007).TheonlyisolatedSRB
abletodegradearomatichydrocarbonsthatisnotaDeltaproteobacteria,istheGram-
positive,Desulfotomaculumsp.OX39(Moraschetal.,2004),capableofo-xylene,o-
ethyltolueneandtoluenedegradation.

53

5Monoaromatichydrocarbondegradation
Methanogenic.Althougharomatichydrocarbondegradationundermethanogeniccon-
ditionswasfirstprovedmorethentwodecadesagoinenrichmentcultures(Grbìc-Galìc
andVogel,1987),andlatelyinsituinanaerobicgroundwaters(Reinhardetal.,2005),so
farnoisolateshadbeenobtainedandonlytwostudieslookedatthephylogenyofmi-
croorganismsinmixedcultures(UlrichandEdwards,2003;Fickeretal.,1999).Benzene
degradingenrichmentculturesweredominatedbytwophylotypes:oneD.anilini-related
phylotypewhichhadasnearestunculturedrelativeasequencefromaSRmarineenrich-
mentdegradingbenzene(Phelpsetal.,1998),andonerelatedtoDesulfosporosinussp.
amicroorganismthatutilizeslactate,pyruvate,ethanolandcertainfattyacids(Ulrichand
Edwards,2003).Anothermethanogeniccultureanalyzedbyamolecularapproachwas
atoluene-degradingmethanogenicenrichmentwhichhadtwodominantphylotypes,one
relatedtoDesulfotomaculumsp.whereasthesecondonedidnotgroupcloselytoknown
microorganisms(Fickeretal.,1999).

ationactivofhanismMecTheanaerobicattackofBTEXcompoundsdiffersdependingontheabsenceorpresence
andtypeofthealkylchain,thereforetheyarediscussedindividuallybelow.
Benzene.Benzenelosswasobservedunderchlorate-,nitrate-,iron(III)-,sulfate-reducing
andmethanogenicconditions(Foght,2008).Althoughabenzenedegradingmicroorgan-
isms,D.aromaticastrainRCB,hasbeenfullysequenced,yetthegenesencodingenzymes
involvedinanaerobichydrocarbondegradationwerenotfound,ontheotherhanddifferent
typesofmonooxygenasesgeneswerepresent(Foght,2008).ThissuggeststhatD.aro-
maticaeithergrewwithtracesofoxygenfromtheculturemediaorunknownenzymes
encodedbyhypotheticalgenesinthegenomeofDechloromonasstrainRCBarecapable
ofbenzeneactivationunderanaerobicconditions.
Presently,theanaerobicactivationmechanismofbenzeneisstillunderconsiderable
debatewithatleastthreepathwaysregardedaspossible:i)hydroxylationtophenolin
methanogenicenrichments(VogelandGrbìc-Galìc,1986;Grbìc-GalìcandVogel,1987;
Ulrichetal.,2005)ii)methylationtotoluene(Coatesetal.,2002;Ulrichetal.,2005),andiii)
carboxylationtobenzoicacid(CaldwellandSuflita,2000;Kunapulietal.,2008)whichcould
resultfrommorethenoneenzymaticreaction(Foght,2008).Latelyithasbeenshownthat
phenolisformedabioticallybyexposuretoairduringthemanipulationofsamples(Kunapuli
etal.,2008).Hence,benzeneactivationbyhydroxylationshouldbeconsideredwithcare.
Tolueneandxylenes.Theactivationofmethyl-substitutedaromaticstakesplaceby
additiontofumarateofcarbonatomfromthemethylgroupadjacenttothering(Figure
5.1).Initially,(alkylbenzyl)succinicacidswereregardedasdead-endmetabolites(Evans
etal.,1992;Frazeretal.,1993).Latertheywereidentifiedasintermediatesintoluene
degradationasdemonstratedundernitrate-(Biegertetal.,1996;BellerandSpormann,
1997;RabusandHeider,1998),sulfate-(RabusandHeider,1998;BellerandSpormann,
1998),iron(III)-reducing(Kaneetal.,2002;BottonandParsons,2007),phototrophic(Zen-

54

gleretal.,1999)andmethanogenic(BellerandEdwards,2000)conditions(reviewedby
SpormannandWiddel,2000;Bolletal.,2002;ChakrabortyandCoates,2004;Heider,
2007).Theproductsofsuchanactivationreactionwereidentifiedforo-andm-xylene
(Kriegeretal.,1999)undernitrate-andsulfate-reducingconditions(Seyfriedetal.,1994;
BellerandSpormann,1997,b;Kriegeretal.,1999;Moraschetal.,2004)andform-xylene
underiron(III)-reducingconditions(BottonandParsons,2007).Ontheotherhand,forp-
xylenesuchintermediatewasdetectedinsulfate-reducingenrichmentcultures,(Morasch
andMeckenstock,2005)butnotindenitrifyingandiron(III)-reducingcultures.Thisislikely
becauseofareducednumberofp-xylenedegradingenrichmentculturesavailableforanal-
ysis.Forreasonsyetunknown,p-xyleneseemsrecalcitranttoanaerobicdegradation,
thereforenoanaerobicisolateshadbeenisolatedyet.
Thefumarateadditionreactioniscatalyzedbybenzylsuccinatesynthaseaheterohexam-
ericenzyme(α2β2γ2)identifiedindifferentdenitrifyingbacteriagrowingontoluene(Leuth-
nerandHeider,2000;Kriegeretal.,2001).Theoperonforthegeneswhichencodeallthree
subunitsofbenzylsuccinatesynthase,plusanactivatingenzymeandaputativechaperone,
wasidentifiedandexpressedindifferentalkylbenzeneutilizingcultures(Leuthneretal.,
1998;Coschigano,2000;Hermuthetal.,2002).Thefunctionalproofoftheactivesub-
unitofbenzylsuccinatesynthase(BssA),wasofamutantwithouttheBssAencodinggene
whichcannotconvertthealkylaromaticsubstrate,whereaswhenthebssAgenewasrein-
troduced,theinitialphenotypewasrecovered(Achongetal.,2001).Theα-subunitofben-
zylsuccinatesynthasewasproposedtofunctionbyaglycyl-radicalattackofthesubstrate,
similartoanotherglycyl-radicalenzyme,pyruvate-formatelyase.Theexistenceofthistype
ofcatalyticactivesiteintheα-subunitofbenzylsuccinatesynthasewasdemonstratedby:
i)theidentificationoftheoxygenolyticcleavageproductofthelargesubunit(α),whichis
knowntooccurinotherglycyl-radicalenzymes(KnappeandSawers,1990):ii)mutagen-
esisandgeneticcomplementationstudieswhichshowedthattheradical-carryingglycine
andoneconservedcysteinefromthecatalyticactivecenterwereessentialforgrowthon
toluene(Coschiganoetal.,1998);andiii)GC-MSonthebenzylsuccinateproducedas
intermediatefrom[deuterated-methyl]toluenewhichsuggestedthatonehydrogenatomis
abstractedfromthemethyl-groupoftoluene(BellerandSpormann,1997).
Similartootherglycyl-radicalenzymes,benzylsuccinatesynthaseislikelyactivatedtothe
radicalform,byanadenosyl-radicalproducedviaone-electron-reductionofS-adenosyl-
methionine.Theadenosyl-radicalabstractsahydrogenfromaglycyl-residuewithinthe
catalyticsubunitofbenzylsuccinatesynthase.Thegylcyl-radicalwillattackaconserved
cysteineformingathiyl-radical,whichfinallyremovesahydrogenatomfromtolueneyield-
ingabenzyl-radical.Next,thebenzyl-radicaladdsatthedoublebondoffumarateforming
thebenzylsuccinyl-radical.Thecycleiscompletedbythetransferthehydrogenfromthe
hydrogen-bearingenzymetothebenzylsuccinylradicalandthetransferoftheradicalback
totheenzyme(Figure5.1)(Heideretal.,1999;Bolletal.,2002;Widdeletal.,2006;Heider,
2007).Presently,eithertheintermediarymetabolites(Beller,2000;Elshahedetal.,2001;Suflita,

55

5Monoaromatichydrocarbondegradation

Figure5.1:Mechanismsofactivationbyadditiontofumarateoftolueneandxylenes.Theactive
formofbenzylsuccinatesynthasehasaglycyl-radicalwhichabstractsonehydrogen
atomfromacysteine-residue.Theresultingthiyl-radicalattackstheinactivealkyl-
benzeneatthemethyl-group,forminganalkylbenzyl-radical,whichattacksthedouble
boundinfumarate,formingan(alkylbenzyl)succinyl-radical.Thethiyl-radicalintheen-
zymeisrecoveredwhilethe(alkylbenzyl)succinyl-radicalrecombineswithahydrogen
atomfromtheinactiveenzyme.Theredsymbols,showwheretheradicalispositioned.
(adaptedafterWiddeletal.,2006).

2002),orthepresenceofthebssAgene,thatencodestheactivesubunitofbenzylsuccinate
synthase(Winderletal.,2007,2008),areconsideredpotentialenvironmentalbiomarkers
formonitoringtherecoveryofcontaminatedareas.
Ethylbenzene.ThesamefumarateadditionmechanismwasobservedinaSRcul-
turethrivingonethylbenzene(Figure5.1).Howeverethylbenzene,wasactivateddiffer-
entlyindenitrifiers,byhydroxylationatthecarbonatomadjacenttothering,forming1-
phenylethanol.Theproveniencefromwaterofthehydroxylgroupin1-phenylethanol,was
demonstratedbyoxygenstableisotopelabeling(Balletal.,1996).Thisreactionisme-
diatedbyethylbenzenedehydrogenase,aMo-Fe-Senzyme(Balletal.,1996;Rabusand
Heider,1998;JohnsonandSpormann,1999;Johnsonetal.,2001;KniemeyerandHeider,
2001).ThegenomeofthedenitrifierEbN1hasbeensequencedanditprovidedinforma-
tionontenanaerobicandfouraerobicpotentialhydrocarbondegradingpathways(Rabus
etal.,2005).Someofthesepathwayswereprovedbyglobalexpressionanalysisattest-
ingthemetabolicversatilityandcomplexregulationofthisorganism(Kuhneretal.,2005;

56

Wöhlbr2007).al.,etand

ypathwadegradationwerLo

AllBTEXaredegradedtoacentralintermediate,benzylacetate,intermediatewhichhas
beenidentifiedinculturesthrivingonanyofthesecompounds(AltenschmidtandFuchs,
1991;Belleretal.,1992;Evansetal.,1992;Seyfriedetal.,1994;Balletal.,1996;Coates
etal.,2002).Howeverthepathtoreachbenzylacetatedifferdependingontheactivation
step,whichinthecaseofbenzeneisunknown.
(Alkylbenzyl)succinicacids,theproductsoffumarateadditiontotoluene,xylenes,and
ethylbenzeneunderSRconditions,enteramodifiedβ-oxidationrouteafteraCoAtrans-
ferasereplacesthesuccinylmoietywithasuccinyl-CoAmoiety.Thiswassupportedby
detectionofCoAtransferaseactivityintoluenegrowncellsofThaueraaromatica(Leutwein
andHeider,2001).ThenextstepisoxidationtoE-(alkylphenyl)itaconyl-CoAwhichwas
supportedbytheidentificationofthecorrespondingacidinculturesgrownontolueneand
xylenes(BellerandSpormann,1997;Moraschetal.,2004).Itisassumedthatthenext
metabolicstepisβ-oxidationto(alkyl)benzyl-CoAandsuccinyl-CoA(LeuthnerandHeider,
2000;LeutweinandHeider,2001).
Ontheotherhand1-phenylethanol,theactivationproductofethylbenzeneunderdeni-
trifyingconditions,isdehydratedfurthertoacetophenone,carboxylatedtobenzoylacetate,
CoAactivated,andthiolyticallycleavedtobenzoyl-CoAandacetyl-CoA(RabusandWiddel,
1995;Balletal.,1996;Widdeletal.,2006).
Subsequentdegradationof(alkyl)benzyl-CoAinvolvesreductivedearomatizationandhy-
drolyticringcleavagefollowedbyβ-oxidation(Harwoodetal.,1999).Howeverinthecase
ofo-andp-xylene,thesecondmethyl-groupinterruptsonenormalroundofβ-oxidation,
anditisyetunknownhowthenextdegradationstepsoccurunderthiscircumstances.

57

5

Monoaromatic

58

ydrocarbonh

adationrdeg

6Polyaromatichydrocarbon
degradation

PAH(poly-nucleararomatichydrocarbons)arestructurallystablemoleculeswithmultiple
fusedbenzeneringsthatarefoundincoaltar,petroleum(TissotandWelte,1984)orare
producedbyplantsandinsects,andsomePAHarerawchemicalsforindustry.Theyare
ratherinactiveduetoalargeπ-electroncloudof10ormoreelectrons,andalackofalkyl
orpolarsubstituents.PAHaresolubleandtoxicandalikeBTEXtheyareregardedas
recalcitrantcontaminantsingroundwaters.Thedegradationofthesemoleculeswasfora
longtimeconsideredunlikelyunderanaerobicconditions,howeverfewstableenrichments
wereobtained,duringthelast15years(reviewedbyMeckenstocketal.,2004b;Foght,
2008).Mostreportsfocusedonnaphthalenedegradationwhichwastheorganicenergy
sourcefornitrate-,sulfate-,iron(III)-andmanganese(IV)-reducingenrichments(Mihelcic
andLuthy,1988a,b;Al-Bashiretal.,1990;Durantetal.,1995;Bregnardetal.,1996;Coates
etal.,996a;Langenhoffetal.,1996;Coatesetal.,1997;Bedessemetal.,1997;Rockne
andStrand,1998)andoffiveanaerobicisolatesgrowingunderdenitrifying(Rockneetal.,
2000)orsulfatereducingconditions(Galushkoetal.,1999;Musatetal.,2009).

PhylogenyThedenitrifyingstrains,NAP-3-1andNAP-4-1(Rockneetal.,2000),were
relatedtoPseudomonasstutzeriandVibriopelagicus,respectively.Whereasthesulfate
reducingstrains,NaphS2(Galushkoetal.,1999),NaphS3andNaphS6(Musatetal.,2009)
groupedwithinDesulfobacteraceaetogetherwithotheraromatichydrocarbondegraders
(Harmsetal.,1999;Kniemeyeretal.,2003).Phylogeneticinformationonmorecomplex
PAHwasobtainedbymolecularanalysisofaphenantreneenrichmentculture,whichhar-
boredaphylotyperelatedtothealkenedegradingHxd3,andonerelatedtoamicroor-
ganismsnevershowntobeinvolvedinhydrocarbondegradation,Desulfofrigusoceanense
(Davidovaetal.,2007).

MechanismofactivationandproposeddegradationThepathwayforanaerobicdegra-
dationofPAHisincompletelyunderstood.Twomechanismsofactivation,similartoben-
zeneactivationwereproposedforthemodelPAH,naphthalene:carboxylationtonaphtoic
acid(ZhangandYoung,1997;Meckenstocketal.,2000;Annweileretal.,2002)andmethy-
lationto2-methylnaphthalene(Safinowskietal.,2006;SafinowskiandMeckenstock,2006).
Aliketoluene,2-methylnaphthalenecouldreactwithfumarateproducing(2-naphthylmethyl)succinate
asobservedin2-methylnaphthalenegrowncultures(Annweileretal.,2000).However,for

59

6Polyaromatichydrocarbondegradation

thesulfatereducingstrainsNaphS2,NaphS3andNaphS6,2-methylnaphthaleneseems
unlikelytoplaytheroleofanintermediateinnaphthalenedegradationsince:1)thegrowth
ofthesestrainswasdelayedon2-methylnaphthalene;2)theαsubunitof(naphthylmethyl)succinate
synthasewasabsentinnaphthalenegrowncells,butidentifiedin2-methylnaphthalene
growncells;and3)cellsgrownonamixof[deuterated]naphthaleneand2-methylnaphthalene
producedunlabeled2-(naphthylmethyl)succinate(Musatetal.,2009).Hencecarboxylation
seemsthemostprobablerouteofnaphthaleneactivationinthesesulfatereducingstrains.
Acarboxylationreactionwassuggestedaswellforanotherunsubstitutedpolyaromatichy-
drocarbon,phenantrene(Davidovaetal.,2007).
Forcultureswheremethylationistheinitialstepofactivation,theupperdegradation
pathwayfornaphthalenedegradationseemstobesimilartothatoftoluenedegradation
(SafinowskiandMeckenstock,2004;Meckenstocketal.,2004b)andfinallyconvergedown
tonaphtoicacid.PAHdegradationisafieldofactiveinterestsincethereareunanswered
questionsregardingi)theoccurrenceofdifferentactivationmechanismsand2)under-
standingthelowerdegradationpathway-thepolyaromaticringopeningandringreduction.

60

7Anaerobicp-xylenedegradation:
discussionsandresults

7.1Scopeofthestudy
Reason:p-Xyleneisoneoftheleastdegradablesubstratesfromthemonoaromaticoil
fractionBTEX.Although,pureculturesorstableenrichmentswereobtainedonalltheother
BTEXunderdifferentelectronacceptingconditions,yetonlythreestableenrichmentshave
beendescribessofaronp-xylene,oneunderdenitrifyingconditions(Haneretal.,1995)
andtheothertwoundersulfatereducingconditions(MoraschandMeckenstock,2005;Nak-
agawaetal.,2008).Thestoichiometriccouplingofsulfatereductionandp-xyleneoxidation
wasdemonstrated,howeverthisisnotthecasefornitrate-reducingenrichmentcultures.
Theactualknowledgegainedonp-xylenedegradationcomesonlyfromsulfatereducing
enrichmentcultures.SequenceanalysisrevealedthataDGGEbandfromonep-xylenede-
gradingenrichmentwasphylogeneticallyrelatedtotheo-xylenedegradingsulfate-reducer,
oXyS1(Harmsetal.,1999),whichisreclassifiedasDesulfosarcinaovata(Kueveretal.,
2005).However,themechanismofp-xyleneactivation,wassuggestedtobesimilartothat
oftolueneafterthediscoveryoftwointermediarymetabolites,4-(methylbenzyl)succinate
and4-(methylbenzyl)itaconate(MoraschandMeckenstock,2005).
Underdenitrifyingconditionsthereisnoinformationaboutthemicroorganismsinvolved,
andthemechanismofp-xylenedegradation.

Scope:Thisworkonp-xylenedegradingenrichmentculturesgrowingunderdenitrifying
conditions,addressedthefollowingpoints:
1.toenrichculturesonp-xyleneandattemptisolation,
2.toidentifyandquantifythedominantmember,
3.todeterminethestoichiometriccouplingofp-xyleneoxidationandnitratereduction,
and4.todeterminethemechanismofp-xyleneactivationunderdenitrifyingconditions.

61

7Anaerobicp-xylenedegradation:resultsanddiscussions
7.2Cultivationofp-xylenedegradingmicroorganisms
conditionsdenitrifyingunder

hmentEnric7.2.1Sediment-containingenrichmentcultureswereestablishedwithnitrateaselectronacceptor
andp-xyleneaselectrondonor.Theinitialnitrateadded(5mM)wasconsumedshortly
uponadditionand5mMofnitratewereresuppliedseveraltimes.Enrichmentswithp-
xylenereducedupto50mMnitrateandconsumedallthep-xyleneaddedduringcirca
650days(AnnexI.Figure13.1A).Incontrast,ap-xylene-freecontrolcultureconsumed25
mMofnitrateincca.450days,whennitratereductionceased.Consecutivesediment-free
subculturesconsumed13to27mMnitratewithin270days(AnnexI.Figure13.1B).

attemptsIsolation7.2.2AerobiccultivationSomedenitrifiersarecapableofgrowthunderoxicconditionsthere-
foreweattemptedisolationonR2Aagar,oronagarsupplementedwithBHIandACmedia.
Samplesweretakenfromthesecondliquiddilutionseries.Growthoccurredafter2to5
days.Weselected58colonies,withdifferentmorphologiesandcolors.Thesecolonies
werefedintoanaerobicmediawith1%p-xylenetodetermineiftheyarecapableofgrowth
onthissubstrate.Howeverweobservednogrowthonp-xyleneunderdenitrifyingcondi-
tionsaftermorethensixmonths.

ationcultivobicAnaer

xtinctiondilution-to-eLiquid1.p-xylene.Sediment-freesubcultureswiththehighestaccumulatednitratereduction
wereusedasinoculaforfoursuccessiveliquiddilutions-to-extinction(1:10)inthe
presenceof1%p-xyleneinHMN(v/v),whichresultedinsediment-freeenrichment
cultures.Growthwithp-xyleneandnitrateinthesehighlyenrichedculturesbecame
fasteranddoublingtimesofapproximately7dayswereobserved.Thehighestdilution
withgrowthwasdominatedbythincurvedrods,0.5μm×2μm(Figure7.2D)which
accountedfor96%ofthecellmorphotypesvisualized.
2.p-xyleneandascorbate.Liquiddilution-to-extinction(1:10)wereestablishedinthe
presenceofp-xylene1%inHMNand1mMascorbate.Growthwasobservedafter
ninedays,incultureswith0.01mlinocula.Uponinspectionofthefirstdilutionby
thephaserestcontroftheastmicroscopmicroorganismsy,weenwereumershoratedtovlessalorthenlarge18%roundthincurcellsve.dInrods,higherwhereasdilu-
tions,lessofthe„p-xylenemorphotype“wasrecovered,whichsuggeststhatpotential
contaminantsmightthriveonascorbatedespitetheselectivepressureofp-xylene.

62

7.3DominanceofnovelBetaproteobacteriainp-xylenedegradingenrichmentcultures
SolidserialagardilutionsSolidagardilutionswereattemptedasdescribedbefore(Wid-
delandBak,1992)with1%p-xyleneinHMNoverlaidontopofthesolidagar,andwithor
without1mMcysteineasreducingagent.Growthwasobservedafter3to2monthsand
colonieswereselectedforfurtherliquidincubations.Fivecoloniesgrewinliquidmedia,
howeveralltheseisolateswerelostatthefollowingtransferstep.Itislikelythatduringthe
handlingprocedures,thesemicroorganismsgetstressedmechanically(pipetting,injecting
etc.)andphysiologically(presenceofoxygenlackofsubstrate,inhibitorsetc.)anddonot
recoverduringincubation.

7.2.3Growthtestsonotherhydrocarbons
Ofallthetestedhydrocarbons,besidesp-xylene,onlytoluenesustainedgrowthanddeni-
trification.Non-hydrocarbonsubstratesutilizedbyourenrichmentswerep-toluicacid,ben-
zoate,fumarateandlactate.Culturedidnotthriveoncholesterol,ando-andm-toluicacid.
Culturesgrownonp-toluicacidandtoluenewererepresentsbyasimilarmorphotypelike
p-xylenegrowncultureswhilstmorecellmorphologieswereobservedinculturesgrownon
substratessuchasbenzoate,fumarate,andlactate.
Culturesdidnotutilizethefollowinghydrocarbons:benzene,ethylbenzene,o-xylene
andm-xylene,2-methylnaphthalene,naphthalene,limonene,n-hexane,cyclohexane,or
.-decanenStrainsisolatedonotherxyleneisomers(Harmsetal.,1999;RabusandWiddel,1995),
wereisomerspecific(o-orm-xylene),andonlystrainOX39wascapabletogrowwithtwo
differentxyleneisomers,o-andm-xylene(Moraschetal.,2004).Inthisstudyweobserved
aswellnoconversionoftheotherxyleneisomers.Thiscouldresultfromdifferencesinthe
specificityoftheactivatingenzyme.Itislikelythatthepositionofthesecondmethylgroup
isrelevantfortheenzymaticattack,consideringthattolueneisafavorablesubstratefor
growthofxylenedegradingstrains.

7.3DominanceofnovelBetaproteobacteriainp-xylene
cultureshmentenricdegradingToidentifythephylogenyofmicroorganismsintwohighlyenrichedp-xylenedenitrifying
cultures,pXyN1andpXyN3,weconstructedclonelibrariesforthe16SrRNAgene(Fig-
ure7.1).Theclonelibrariesoftheseenrichmentsweredominatedbyonephylotype(se-
quenceswith≥98.5%identity).ThisphylotypewascloselyrelatedtotheBetaproteobacte-
ria,Denitratisomaoestradiolicum(95%identity).Othercloserelativesincludestrain72Chol
(94.4%)andSterolibacteriumdenitrificans(94.2%).Thisphylotypewasonlydistantlyre-
latedtotwoAzoarcusmembers:thecyclohexane-1,2-dioldegradingstrainLin22(91.4%),
thepropylbenzenedegradingstrainPbN1(90.9%)andtoDechloromonasaromaticastrain
RCB(91.1%).FromtheThaueragrouptheclosestrelativeisthetoluenedegrader,Thauera

63

7Anaerobicp-xylenedegradation:resultsanddiscussions
aromaticaK172(Andersetal.,1995).Otherfivephylotypeswerefound,threerelatedto
Denitratisomaoestradiolicum(84.4to94%),onetoChlorobiumphaeobacteroidesDSM
266(80%identity)andonetocandidatedivisionOP11sequencesfromariverestuary
mangrove(89.8%identity)(Figure12.5).

Figure7.1:MaximumlikelihoodtreeofBe-
taproteobacteriashowingthedom-
inant16SrRNAphylotype(gray
boxes)intwoenrichmentcultures
(pXyN3andpXyN1)grownon
p-xyleneassoleenergysource.
ThearrowpointstoDeinococcus
specieswhichwereusedasout-
group.Thescalebarmeasures
distanceas5%similarityperbar
length.

Toresolvetherelativedominanceoftheorganismsintheenrichments,weappliedFISH
withphylum-togroup-specificoligonucleotideprobes(Table12.2)(Amannetal.,1990b).
AllbacteriaweredetectedwithaDNAstain(4’.6-diamidino)2-phenylindol(DAPI).Wede-
terminedtherelativepercentageofprobetargetedcellsinrelationtothenumberofDAPI
stainedcells(Figure12.4).ThegeneralBacteriaprobe(Eub-338I-III)hybridized97%of
thetotalcellsinbothenrichmentcultures(Figure7.2A).TheclassspecificBetaproteobac-
teriaprobe(Bet-42a),hybridizedtomorethan93%cellsinbothenrichments(Figure7.2B
).Newlydesignedprobes(pxyn-440andpxyn-644)specificfortheDenitratisoma-related
phylotypewhichdominatedbothclonelibraries,targetedmorethan91%ofcellsinboth
enrichmentcultures(Figure7.2C).
Thisisthefirsttimeadenitrifyingcommunitydegradingp-xylenehasbeendescribed.It
issurprisingthatthedominantphylotypedidnotgroupwithotherhydrocarbon-degradersof
theAzoarcus-Thaueracluster,butwithsteroiddegradersfromtheDenitratisoma-Sterolibacterium
group.Asimilarobservationwasmadeonbenzenedegradingdenitrifyingenrichments,
whereSterolibacterium-relatedorganismsdominatedaswell.Itispossiblethatanew
genusrelatedtosteroiddegraderscomprisesunculturedhydrocarbondegradingmicroor-
.ganisms

64

7.3DominanceofnovelBetaproteobacteriainp-xylenedegradingenrichmentcultures

Figure7.2:Microscopicimagesofcellsinadenitrifyingenrichmentculturewithp-xylene.Im-
agesA,BandCaresuperimposedDAPIandprobesignals.Cellsnottargeted
bytheoligonucleotideprobeappearblue(DAPIsignal)whileprobe-targetedcells
appearred.Thescalebaris5μm.A)CellsstainedwithDAPIandhybridized
withaBacteria-specificprobemix(EubI-III).B)CellsstainedwithDAPIandhy-
bridizedwithprobeBet42aspecificforBetaproteobacteria.C)Cellsstainedwith
DAPIandhybridizedwithprobepxyn-440designedforthedominantphylotype
retrievedfromtwop-xylenedegradingenrichments.D)Phasecontrastmicro-
graphofviablecells.

Figure7.3:EnumerationofcellsstainedwithCy-3labeledprobesversusDAPIstainedcells
intwodenitrifyingcultureshighlyenrichedonp-xylene(pXyN1andpXyN3).The
nonsenseprobe,Non-338,althoughapplieditstained0%cells,thereforeitisnot
.hererepresented

65

7Anaerobicp-xylenedegradation:resultsanddiscussions

7.4Quantificationofp-xylenedegradation
Catabolismwasquantitativelymonitoredfor80daysinculturesgrownwithalowamount
ofhydrocarbon(Table12.1).Culturesincubatedwithp-xyleneconsumedallthenitrate
added(Figure7.4).Toelucidatewhethernitrateisreducedtoammonium,wemeasured
theammoniumconcentrationinthecellculturemediumandobservedthatattheendof
theincubation,itdecreasedwith1μM.Todeterminewhethernitrateisreducedtoother
intermediatesinsteadofdinitrogengas,nitriteandnitrousoxideweremeasured.The
concentrationsofnitritedidnotchange,whereasnitrousoxidewasnotdetectedduring
ation.cultiv

Figure7.4:Nitratereduction(filledup-triangles)andopticaldensity(filledcircles)increase(panel
A)inasedimentfreeculture,pXyN1whichdegradesp-xylene(filleddown-trianglesin
panelB).Inaninoculatedcontrolthereisnosignificantdecreaseofnitrate(openedup-
triangles).Insterilecontrolsnomajorhydrocarbonlosshasbeendetected(opendown-
triangles).Thevaluesfornitrateandp-xyleneareaverageofduplicatemeasurements.

Thenitrateconsumedbyap-xylenedegradingculturewas3.46±0.07mmolwhich
couldaccept17.3±0.3mmolofreducingequivalents(Table12.1)ifcompletelyreduced
todinitrogengas.Thephysicallossofp-xylenewaslow,asobservedinasterilecontrol.
Fromdryweightmeasurements,weestimatedthat2.2μmolp-xylenewereassimilated
intobiomass(seeTable12.1).Theamountofp-xyleneincorporatedintobiomasswas
calculatedusingtheassimilatoryreaction:17C8H10+32HCO3−+32H++30H2O→
42C4H7O3.Thetotalamountofp-xylenecatabolizedwasof0.50±0.08mmol,which
coulddonate20.9±3.3mmolreducingequivalentsifcompletelyoxidizedtocarbondiox-
ide.Thecompleteoxidationofp-xyleneaccordingtotheequationC8H10+8.4NO3−+

66

7.5Mechanismofp-Xyleneactivation
8.4H+→8CO2+4.2N2+9.2H2O(ΔG0’is-4202.6kJmol−1p-xylene),issupported
bytheelectronbalance(Table12.1)andalackoffattyacidsaccumulationintheculture
media.Hereweshowforthefirsttimethestoichiometriccouplingofp-xyleneoxidationto
nitratereduction.Anotherstudyproposedacompleteoxidationofp-xyleneunderdenitri-
fyingculturesbasedonsimilarratesofelectrontransferredfromtheelectrondonortothe
electronacceptor,duringexponentialgrowth(Haneretal.,1995).Whereasundersulfate
reducingconditionsp-xyleneoxidationwasstoichiometricallycoupledtoreductionofsul-
fate(MoraschandMeckenstock,2005;Nakagawaetal.,2008).Althoughconsumptionof
p-xylenewasalsodetectedunderironreducingandmethanogenicconditions,theprocess
hasnotbeenstudiedquantitatively(BottonandParsons,2007).

7.5Mechanismofp-Xyleneactivation
Inacidifiedandmethylatedextractsofculturesgrownwith5mMnitrateand2%p-xylenein
HMN(v/v),twometabolitesweredetectedasdimethylesters.Basedonrelativeretention
times,massspectraandcomparisontopublishedspectra,weidentifiedthetwodimethyl
estersinourdenitrifyingculturesasdimethylestersof(4-methylbenzyl)succinate,and(4-
methylphenyl)itaconate.Themassspectraof(4-methylbenzyl)succinicaciddimethylester
showedthemolecularionatm/z250,thebasepeakatm/z105andfurtherkeyfragment
ionsatm/z131,145,177and190(Figure12.6A).Themassspectrumof(4-methylphenyl)
itaconicaciddimethylestershowedthemolecularionatm/z248,thebasepeakatm/z
129andfurtherkeyfragmentsatm/z115,188and216(Figure12.6B).
Theirmassfingerprintsweresimilartocompoundsfoundinsulfatereducingenrichments
whichconsumep-xylene(Elshahedetal.,2001;MoraschandMeckenstock,2005).The
relativeretentiontimesofbothmetabolitesweresignificantlydifferentfromthoseofthe
correspondingo-andm-substitutedanaloguesformedfromo-andm-xylenebythesul-
fatereducingstrainOX39,respectively(Moraschetal.,2004).Thepresenceofthese
metabolitessuggestasimilardegradationpathway(Figure7.7)asdescribedfortoluene
andm-xyleneinthedenitrifiersThaueraaromaticaandAzoarcussp.strainT,respectively
(Biegertetal.,1996;Kriegeretal.,1999;LeuthnerandHeider,2000).However,afterring
cleavage,thepara-methylgroupwouldpreventonestepofregularβ-oxidation.Themech-
anismbywhichthis„obstacle“isby-passedisstillunknown.Furthermoreweamplifiedand
sequencedthebssAgenewithspecificprimers(Winderletal.,2007,2008)andidentified
itsrelationshipsattheaminoacidleveltootherbenzylsuccinatesynthases.Thisaminoacid
sequencegroupedtogetherwithotherdenitrifyingmicroorganismscapableofhydrocarbon
degradation(Figure7.6)havingascloserelative(84%aminoacidsimilarity)theα-subunit
ofbenzylsuccinatesynthase(TutD)fromThaueraaromatica.Theintermediarymetabolites
andthebssAgeneareusefulmolecularbiomarkersofalkylbenzenedegradationinthe
environment(Belleretal.,1995;Elshahedetal.,2001;Suflita,2002;Winderletal.,2008).

67

7Anaerobicp-xylenedegradation:resultsanddiscussions

68

p-xylenep3.65(B)-xylenep3.62(A)-xylenep
-xylene-3.58(mmol)30.180.06±0.03±3.653.620.01±initial−
-xylenepCreaction:17assimilationtheingconsider
mmol0.0039requiresmassofdissimilationingdurdonatedelectronsofamountofamountthecorrectedew,lySimilar.culturecontrolinoculatednanidevobseratenitroflosstheybdonatedandatenitrybaccepted**Electronsbcalculatedsawp-xyleneandatenitrofdepletionThe*.oneinitialthefromaluevmeasuredfinaltheactingsubtrywithoutCellswithcontrolileSterwithCellswithCellsNOCulture
0.50consumed*NO(mmol)8Hp-10xylene(mmol)initialassimilatedamountthexcludingeybcalculatedsaw-xyleneptotalthefrombiomassinto
3+3p2H±(mmol)consumed*-xylene2Oingconsidercalculatederewxylenep-actingsubtrybcorrectedsawusedatenitrofamountThe.culturesybusedsourcesenergytheseofamountsthe
→−theactingsubtrybculturesichmentenrybconsumedxylenep-
C42(mg)massydrCell
0H+3+17.30.580.0617.20.560.08±
4--0.07±---0.110.030.05±±0.570.000.490.01±3−
H7O3OC2H+3-----0.05±0.530.02±0.460.05±
±±(mmol)0.030.03.ydrcellmg2.1assumedeWdisappeared.thatxylenep-accepted***Electrons
20.918.0p-Thecontrol.ilesterainlostxylene
(mmol)donated**Electrons±833.30964.00±
recov±±Electronsered1622(%)

lbaT7.1:e
p-mmol.4sawaddedatenitrofamounttheoreticalTherofiercarrasHMNml40withlaidervoofQuantification
ofamounttheoreticalThe.-xylenep
reductionatenitrandconsumptionxyleneml,400ofolumevcultureain25%sawinoculaThe.culturesichedenrhighlyotwin
wadded-xylenep(v/v).HMNin0.2%tocorrespondingmmol0.616sa

7.5MechanismThesedatasupportp-xylenedegradationviafumarateaddition.

7.5:Figure

Massaspectrfowtoylatedmethintermediarymetabolitesobtainedfromofculturesrgationactiv-Xylenep

wonwithp-xyleneassoleorganicenergysource:A)(4-methylbenzyl)succinicaciddimethylester,andB)(4-methylphenyl)itaconicacid
.esteryldimeth

69

7Anaerobicp-xylenedegradation:resultsanddiscussions

Figure7.6:PhylipProMLtreeofbssAgenesequencesencoding(alkyl-
benzyl)succinatesynthase.InboldistheBssAsequencere-
trievedfromahighlyenrichedp-xylenedegradingculture.In
parenthesisaretheNCBIaccessionnumbersfortheamino
acidsequenceusedfortheanalysis.Thescalebarrepre-
sents10%differenceinaminoacididentity.

outlookandlusionsConc7.6Inthisstudyweobtainedahighlyenrichedculture,withlessthen6%contaminants,thatis
capabletoactivatep-xylenebyfumarateadditionandoxidizeitfurther,whileusingnitrate
asterminalelectronacceptor.Themicroorganismwhichdegradesp-xyleneeludedisola-
tioninsolidagar.However,liquiddilution-to-extinctionserieshelpedtoincreasetheirnum-
bers.Inspectionofculturesbyphasecontrastmicroscopy,showedthedominanceof0.5
μm×2μmthinrods.ThesamerodsweredeterminedwithspecificFISHprobesandrep-
resentalmosttheentirebacterialpopulation.Thesedominantmicroorganismsbranched
separatelyfromotheralkylbenzenedegradersfromBetaproteobacteriahavingasnextrela-
tive,steroidutilizingdenitrifiers,ofthegenusDenitratisomaandSterolibacterium.However,
sinceourculturesshowedmorethen5%differencetosteroidutilizersandwerefunctionally
unrelatedtotheseorganisms,wesuggesttheybelongtoanindependentgenuswithinBe-
taproteobacteria.Inadenitrifyingbenzeneutilizingenrichmentcultureslot-blothybridiza-
tionrevealedaswellthedominanceofSterolibacterium-relatedDNA(UlrichandEdwards,
2003).Hencethecapabilitytoutilizearomatichydrocarbonsseemstodivergetounknown
ia.BetaproteobacterwithinagenerSincenoorganismwasculturedyetonp-xylene,ofalltheBTEX,itisofhighrelevance
topursuefurtheronwithisolationofthesemicroorganisms.Thereisextensiveinformation
ontheactivationofalkylbenzenes,howevertwoxyleneisomersp-xylene,ando-xylene
arelikelyfollowingadifferentlowerpathofdegradationbypassingonenormalroundof
β-oxidation.Aninterestingquestionthatarisesis„Whatenzymecatalyzesthisstep?“
Substrateinducedexpressionanalysis,couldclarifymoreabouttheenzymesinvolvedin
thedegradationpathwayoftolueneversusp-xylene.Differencesinthelattercouldbedue
todifferentenzymesemployedinthelowerdegradationpathwayofp-xylene.

70

outlookandConclusions7.6

Furthermoreithasbeenobservedformostalkylbenzenedegradersthattheyareex-
tremelyspecializedonthetypeofhydrocarbonsubstrateused.Hencemostxylenede-
graders,arespecializedonthedegradationofonexyleneisomer.Whatkindofenzyme
stereo-chemistrydefinesthesubstrate-enzymeinteractions?Andhowmicrobesmakeuse
ofthisselectivebehaviorintheenvironment?Theseareonlysomeofthequestionsthat
remaintobeanswered.

Figure7.7:Proposedpathwayforp-xylenedegradationbydenitrifyingcultures.Evidencefortheproposedinitial
reactionsarepresentedinthetext.Fumarateadditionresultsin(4-methylbenzyl)succinicacid.The
succinylmoietyislikelyreplacedbysuccinyl-CoAresultingin(4-methyphenyl)itaconyl-CoA.The
hypothesizedremovalofsuccinyl-CoAandCoA-thioesterificationcouldgeneratethecentralinter-
mediate(4-methylbenzoyl)-CoA.Thelowerpathwaystartswitharomaticringreduction,followedby
hydrationdehydrogenation,ringcleavageandβ-oxidation.Dottedlinesillustrateseveralinterme-
.stepsydiar

71

7Anaerobic72

p

-xylenerdegadation:resultsanddiscussions

Ref8erences

Achong,G.,Rodriguez,A.,andSpormann,A.(2001).BenzylsuccinatesynthaseofAzoar-
cussp.strainT:cloning,sequencing,transcriptionalorganization,anditsroleinanaero-
bictolueneandm-xylenemineralization.J.Bacteriol.,183(23):6763–6770.

Al-Bashir,B.,Cseh,T.,Leduc,R.,andSamson,R.(1990).Effectofsoil/contaminantinter-
actionsonthebiodegradationofnaphthaleneinfloodedsoilunderdenitrifyingconditions.
34(3):414–419.,Biotechnol.Microbiol.Appl.

Altenschmidt,U.andFuchs,G.(1991).Anaerobicdegradationoftolueneindenitrifying
Pseudomonassp.:indicationfortoluenemethylhydroxylationandbenzoyl-CoAascentral
aromaticintermediate.Arch.Microbiol.,156(2):152–158.

Amann,R.,Binder,B.,Olson,R.,Chisholm,S.,Devereux,R.,andStahl,D.(1990).Com-
binationof16SrRNA-targetedoligonucleotideprobeswithflowcytometryforanalyzing
mixedmicrobialpopulations.AppliedandEnvironmentalMicrobiology,56(6):1919–1925.

Anders,H.,Kaetzke,A.,Ktmpfer,P.,Ludwig,W.,andFuchs,G.(1995).Taxonomicposition
ofaromaticdegradingdenitrifyingpseudomonadstrainsK172andKB740.Description
ofanewmemberofthegenusThauera,Thaueraaromaticasp.nov.andofthegenus
Azoarcus,Azonrmsevansiisp.nov.,membersofthebetasubclassoftheProteobacteria.
Int.J.Syst.Bacteriol.,45:327–333.

Annweiler,E.,Materna,A.,Safinowski,M.,Kappler,A.,Richnow,H.,Michaelis,W.,and
Meckenstock,R.(2000).Anaerobicdegradationof2-methylnaphthalenebyasulfate-
reducingenrichmentculture.Appl.Environ.Microbiol.,66(12):5329–5333.

Annweiler,E.,Michaelis,W.,andMeckenstock,R.(2002).Identicalringcleavageproducts
duringanaerobicdegradationofnaphthalene,2-methylnaphthalene,andtetralinindicate
anewmetabolicpathway.Appl.Environ.Microbiol.,68(2):852.

AssociationofpetrochemicalsproducersinEurope,A.P.P.E.(2006).Aromatics-capacity
andproductiondata.URLhttp://www.petrochemistry.net/capacity-and-production-
.html.aromatics

Atlas,R.(1981).Microbialdegradationofpetroleumhydrocarbons:anenvironmentalper-
spective.Microbiol.Molec.Biol.Rev.,45(1):180–209.

73

erencesRef8Ball,H.,Johnson,H.,Reinhard,M.,andSpormann,A.(1996).Initialreactionsin
anaerobicethylbenzeneoxidationbyadenitrifyingbacterium,strainEB1.J.Bacteriol.,
178(19):5755–5761.Ball,H.andReinhard,M.(1996).Monoaromatichydrocarbontransformationunderanaer-
obicconditionsatSealBeach,California:Laboratorystudies.Environ.Toxicol.Chem.,
15(2):114–122.Bedessem,M.,Swoboda-Colberg,N.,andColberg,P.(1997).Naphthalenemineraliza-
tioncoupledtosulfatereductioninaquifer-derivedenrichments.FEMSMicrobiol.Lett.,
152(2):213–218.Beller,H.(2000).Metabolicindicatorsfordetectinginsituanaerobicalkylbenzenedegra-
dation.Biodegradation,11(2):125–139.
Beller,H.andEdwards,E.(2000).Anaerobictolueneactivationbybenzylsuccinatesyn-
thaseinahighlyenrichedmethanogenicculture.Appl.Environ.Microbiol.,66(12):5503–
5505.Beller,H.,Reinhard,M.,andGrbic-Galic,D.(1992).Metabolicby-productsofanaerobic
toluenedegradationbysulfate-reducingenrichmentcultures.Appl.Environ.Microbiol.,
58(9):3192–3195.Beller,H.andSpormann,A.(1997a).Anaerobicactivationoftolueneando-xyleneby
additiontofumarateindenitrifyingstrainT.J.Bacteriol.,179(3):670–676.
Beller,H.andSpormann,A.(1997b).Benzylsuccinateformationasameansofanaer-
obictolueneactivationbysulfate-reducingstrainPRTOL1.Appl.Environ.Microbiol.,
63(9):3729–3731.Beller,H.andSpormann,A.(1998).Analysisofthenovelbenzylsuccinatesynthasere-
actionforanaerobictolueneactivationbasedonstructuralstudiesoftheproduct.J.
,iol.Bacter180(20):5454–5457.Beller,H.,Spormann,A.,Sharma,P.,Cole,J.,andReinhard,M.(1996).Isolationand
characterizationofanoveltoluene-degrading,sulfate-reducingbacterium.Appl.Environ.
62(4):1188.,Microbiol.Biegert,T.,Fuchs,G.,andHeider,J.(1996).Evidencethatanaerobicoxidationoftoluenein
thedenitrifyingbacteriumThaueraaromaticaisinitiatedbyformationofbenzylsuccinate
fromtolueneandfumarate.Eur.J.Biochem.,238(3):661–8.
Boll,M.,Fuchs,G.,andHeider,J.(2002).Anaerobicoxidationofaromaticcompoundsand
hydrocarbons.Curr.Op.Chem.Biol.,6(5):604–611.
Botton,S.andParsons,J.(2007).DegradationofBTXbydissimilatoryiron-reducingcul-
tures.Biodegradation,18(3):371–381.

74

Bregnard,T.,Höhener,P.,Häner,A.,andZeyer,J.(1996).Degradationofweathered
dieselfuelbymicroorganismsfromacontaminatedaquiferinaerobicandanaerobic
microcosms.Environ.Toxicol.Chem.,15(3):299–307.
Caldwell,M.andSuflita,J.(2000).Detectionofphenolandbenzoateasintermediates
ofanaerobicbenzenebiodegradationunderdifferentterminalelectron-acceptingcondi-
tions.Environ.Sci.Technol,34(7):1216–1220.
Chakraborty,R.andCoates,J.(2004).Anaerobicdegradationofmonoaromatichydrocar-
bons.Appl.Microbiol.Biotechnol.,64(4):437–446.
Coates,J.,Anderson,R.,Woodward,J.,Phillips,E.,andLovley,D.(1996a).Anaerobic
hydrocarbondegradationinpetroleum-contaminatedharborsedimentsundersulfate-
reducingandartificiallyimposediron-reducingconditions.Environ.Sci.Technol,
30(9):2784–2789.Coates,J.,Bhupathiraju,V.,Achenbach,L.,McInerney,M.,andLovley,D.(2001a).
Geobacterhydrogenophilus,GeobacterchapelleiandGeobactergrbiciae,threenew,
strictlyanaerobic,dissimilatoryFe(III)-reducers.Int.J.Syst.Evol.Microbiol.,51(2):581–
588.Coates,J.,Chakraborty,R.,Lack,J.,O’Connor,S.,Cole,K.,Bender,K.,andAchenbach,
L.(2001b).Anaerobicbenzeneoxidationcoupledtonitratereductioninpurecultureby
twostrainsofDechloromonas.Nature,411(6841):1039–1043.
Coates,J.,Chakraborty,R.,andMcInerney,M.(2002).Anaerobicbenzenebiodegradation:
anewera.Res.Microbiol.,153(10):621–628.
Coates,J.,Woodward,J.,Allen,J.,Philp,P.,andLovley,D.(1997).Anaerobicdegrada-
tionofpolycyclicaromatichydrocarbonsandalkanesinpetroleum-contaminatedmarine
harborsediments.Appl.Environ.Microbiol.,63(9):3589.
Coschigano,P.(2000).TranscriptionalanalysisofthetutEtutFDGHgeneclusterfrom
ThaueraaromaticastrainT1.Appl.Environ.Microbiol.,66(3):1147–1151.
Coschigano,P.,Wehrman,T.,andYoung,L.(1998).Identificationandanalysisofgenes
involvedinanaerobictoluenemetabolismbystrainT1:putativeroleofaglycinefree
radical.Appl.Environ.Microbiol.,64(5):1650–1656.
Davidova,I.,Gieg,L.,Duncan,K.,andSuflita,J.(2007).Anaerobicphenanthrenemineral-
izationbyacarboxylatingsulfate-reducingbacterialenrichment.ISMEJ.,1(5):436–442.
Dolfing,J.,Zeyer,J.,Binder-Eicher,P.,andSchwarzenbach,R.(1990).Isolationandchar-
acterizationofabacteriumthatmineralizestolueneintheabsenceofmolecularoxygen.
154(4):336–341.,Microbiol.Arch.

75

erencesRef8

Durant,N.,Wilson,L.,andBouwer,E.(1995).MicrocosmstudiesofsubsurfacePAH-
degradingbacteriafromaformermanufacturedgasplant.J.Contam.Hydrol.,17(3):213–
237.Elshahed,M.,Gieg,L.,McInerney,M.,andSuflita,J.(2001).Signaturemetabolitesat-
testingtotheinsituattenuationofalkylbenzenesinanaerobicenvironments.Environ.
Science&Technol.,35(4):682–689.
Evans,P.,Ling,W.,Goldschmidt,B.,Ritter,E.,andYoung,L.(1992).Metabolitesformed
duringanaerobictransformationoftolueneando-xyleneandtheirproposedrelationship
totheinitialstepsoftoluenemineralization.Appl.Environ.Microbiol.,58(2):496–501.
Evans,P.,Mang,D.,Kim,K.,andYoung,L.(1991).Anaerobicdegradationoftoluenebya
denitrifyingbacterium.Appl.Environ.Microbiol.,57(4):1139–1145.
ExxonValdezOilSpillTrusteeCouncil(2009).Statusofinjuredresourcesandservices.
URLhttp://www.evostc.state.ak.us/recovery/status.cfm.
Foght,J.(2008).Anaerobicbiodegradationofaromatichydrocarbons:pathwaysand
prospects.J.Mol.Microbiol.Biotechnol.,15(2-3):93–120.
Frazer,A.,Ling,W.,andYoung,L.(1993).Substrateinductionandmetaboliteaccumulation
duringanaerobictolueneutilizationbythedenitrifyingstrainT1.Appl.Environ.Microbiol.,
59(9):3157–3160.Fries,M.,Zhou,J.,Chee-Sanford,J.,andTiedje,J.(1994).Isolation,characterization,and
distributionofdenitrifyingtoluenedegradersfromavarietyofhabitats.Appl.Environ.
60(8):2802–2810.,Microbiol.Galushko,A.,Minz,D.,Schink,B.,andWiddel,F.(1999).Anaerobicdegradationofnaph-
thalenebyapurecultureofanoveltypeofmarinesulphate-reducingbacterium.Environ.
1:415–420.,Microbiol.Grbìc-Galìc,D.andVogel,T.(1987).Transformationoftolueneandbenzenebymixed
methanogeniccultures.Appl.Environ.Microbiol.,53(2):254–260.
Harms,G.,Rabus,R.,andWiddel,F.(1999a).Anaerobicoxidationofthearomatic
planthydrocarbonp-cymenebynewlyisolateddenitrifyingbacteria.Arch.Microbiol.,
172(5):303–312.Harms,G.,Zengler,K.,Rabus,R.,Aeckersberg,F.,Minz,D.,Rossello-Mora,R.,andWid-
del,F.(1999b).Anaerobicoxidationofo-xylene,m-xylene,andhomologousalkylben-
zenesbynewtypesofsulfate-reducingbacteria.Appl.Environ.Microbiol.,65(3):999–
1004.Harwood,C.,Burchhardt,G.,Herrmann,H.,andFuchs,G.(1999).Anaerobicmetabolism
ofaromaticcompoundsviathebenzoyl-CoApathway.FEMSMicrobiol.Rev.,22(5):439–
458.

76

Heider,J.(2007).Addinghandlestounhandysubstrates:anaerobichydrocarbonactivation
mechanisms.Curr.Op.Chem.Biol.,11(2):188–194.
Heider,J.,Spormann,A.,Beller,H.,andWiddel,F.(1999).Anaerobicmetabolismofhy-
drocarbons.FEMSMicrobiol.Rev,22:459–473.
Hermuth,K.,Leuthner,B.,andHeider,J.(2002).Operonstructureandexpressionofthe
genesforbenzylsuccinatesynthaseinThaueraaromaticastrainK172.Arch.Microbiol.,
177(2):132–138.Hess,A.,Zarda,B.,Hahn,D.,Haner,A.,Stax,D.,Hohener,P.,andZeyer,J.(1997).In
situanalysisofdenitrifyingtoluene-andm-xylene-degradingbacteriainadieselfuel-
contaminatedlaboratoryaquifercolumn.Appl.Environ.Microbiol.,63(6):2136–2141.
Johnson,H.,Pelletier,D.,andSpormann,A.(2001).Isolationandcharacterization
ofanaerobicethylbenzenedehydrogenase,anovelMo-Fe-Senzyme.J.Bacteriol.,
183(15):4536–4542.Johnson,H.andSpormann,A.(1999).Invitrostudiesontheinitialreactionsofanaerobic
ethylbenzenemineralization.J.Bacteriol.,181(18):5662–5668.
Kane,S.,Beller,H.,Legler,T.,andAnderson,R.(2002).Biochemicalandgeneticevi-
denceofbenzylsuccinatesynthaseintoluene-degrading,ferriciron-reducingGeobacter
metallireducens.Biodegradation,13(2):149–154.
Kasai,Y.,Takahata,Y.,Manefield,M.,andWatanabe,K.(2006).RNA-basedstable
isotopeprobingandisolationofanaerobicbenzene-degradingbacteriafromgasoline-
contaminatedgroundwater.Appl.Environ.Microbiol.,72(5):3586–3592.
Knappe,J.andSawers,G.(1990).Aradical-chemicalroutetoacetyl-CoA:theanaerobi-
callyinducedpyruvateformate-lyasesystemofEscherichiacoli.FEMSMicrobiol.Lett.,
75(4):383–398.Kniemeyer,O.,Fischer,T.,Wilkes,H.,Glockner,F.,andWiddel,F.(2003).Anaerobic
degradationofethylbenzenebyanewtypeofmarinesulfate-reducingbacterium.Appl.
69(2):760–768.,Microbiol.viron.EnKniemeyer,O.andHeider,J.(2001).Ethylbenzenedehydrogenase,anovelhydrocarbon-
oxidizingmolybdenum/iron-sulfur/hemeenzyme.J.Biol.Chem.,276(24):21381–21386.
Krieger,C.,Beller,H.,Reinhard,M.,andSpormann,A.(1999).Initialreactionsinanaerobic
oxidationofm-xylenebythedenitrifyingbacteriumAzoarcussp.strainT.J.Bacteriol.,
181(20):6403–6410.Krieger,C.,Roseboom,W.,Albracht,S.,andSpormann,A.(2001).Astableorganicfree
radicalinanaerobicbenzylsuccinatesynthaseofAzoarcussp.strainT.J.Biol.Chem.,
276(16):12924–12927.

77

erencesRef8Kuever,J.,Rainey,F.,andWiddel,F.(2005).GenusX.DesulfosarcinaWiddel1981,382VP
(Effectivepublication:Widdel1980,382).Bergey’sManualofSystematicBacteriology,
2:981–984.Kuhn,E.,Colberg,P.,Schnoor,J.,Wanner,O.,Zehnder,A.,andSchwarzenbach,R.
(1985).Microbialtransformationsofsubstitutedbenzenesduringinfiltrationofriverwater
togroundwater:laboratorycolumnstudies.Environ.Sci.Technol,19(10):961–968.
Kuhn,E.,Zeyer,J.,Eicher,P.,andSchwarzenbach,R.(1988).Anaerobicdegradationof
alkylatedbenzenesindenitrifyinglaboratoryaquifercolumns.Appl.Environ.Microbiol.,
54(2):490–496.Kuhner,S.,Wohlbrand,L.,Fritz,I.,Wruck,W.,Hultschig,C.,Hufnagel,P.,Kube,M.,Rein-
hardt,R.,andRabus,R.(2005).Substrate-dependentregulationofanaerobicdegrada-
tionpathwaysfortolueneandethylbenzeneinadenitrifyingbacterium,strainEbN1.J.
187(4):1493–1503.,iol.BacterKunapuli,U.,Griebler,C.,Beller,H.,andMeckenstock,R.(2008).Identificationofinter-
mediatesformedduringanaerobicbenzenedegradationbyaniron-reducingenrichment
culture.Environ.Microbiol.,10(7):1703.
Langenhoff,A.,Zehnder,A.,andSchraa,G.(1996).Behaviouroftoluene,benzeneand
naphthaleneunderanaerobicconditionsinsedimentcolumns.Biodegradation,7(3):267–
274.Leuthner,B.andHeider,J.(2000).AnaerobictoluenecatabolismofThaueraaromatica:
thebbsoperoncodesforenzymesofβ-oxidationoftheintermediatebenzylsuccinate.
J.Bacteriol.,182(2):272–277.
Leuthner,B.,Leutwein,C.,Schulz,H.,Horth,P.,Haehnel,W.,Schiltz,E.,Schagger,H.,
andHeider,J.(1998).Biochemicalandgeneticcharacterizationofbenzylsuccinatesyn-
thasefromThaueraaromatica:anewglycylradicalenzymecatalysingthefirststepin
anaerobictoluenemetabolism.Molec.Microbiol.,28(3):615–628.
Leutwein,C.andHeider,J.(2001).Succinyl-CoA:(R)-benzylsuccinateCoA-transferase:an
enzymeoftheanaerobictoluenecatabolicpathwayindenitrifyingbacteria.J.Bacteriol.,
183(14):4288–4295.Lovley,D.,Giovannoni,S.,White,D.,Champine,J.,Phillips,E.,Gorby,Y.,andGoodwin,
S.(1993).Geobactermetallireducensgen.nov.sp.nov.,amicroorganismcapableof
couplingthecompleteoxidationoforganiccompoundstothereductionofironandother
159(4):336–344.,Microbiol.Arch.metals.Lovley,D.andLonergan,D.(1990).Anaerobicoxidationoftoluene,phenol,andp-cresolby
thedissimilatoryiron-reducingorganism,GS-15.Appl.Environ.Microbiol.,56(6):1858–
1864.

78

Meckenstock,R.(1999).Fermentativetoluenedegradationinanaerobicdefinedsyntrophic
cocultures.FEMSMicrobiol.Lett.,177(1):67–73.
Meckenstock,R.,Annweiler,E.,Michaelis,W.,Richnow,H.,andSchink,B.(2000).Anaer-
obicnaphthalenedegradationbyasulfate-reducingenrichmentculture.Appl.Environ.
66(7):2743–2747.,Microbiol.Meckenstock,R.,Safinowski,M.,andGriebler,C.(2004b).Anaerobicdegradationofpoly-
cyclicaromatichydrocarbons.FEMSMicrobiol.Ecol.,49(1):27–36.
Mihelcic,J.andLuthy,R.(1988a).Degradationofpolycyclicaromatichydrocarboncom-
poundsundervariousredoxconditionsinsoil-watersystems.Appl.Environ.Microbiol.,
54(5):1182–1187.Mihelcic,J.andLuthy,R.(1988b).Microbialdegradationofacenaphtheneandnaphtha-
leneunderdenitrificationconditionsinsoil-watersystems.Appl.Environ.Microbiol.,
54(5):1188–1198.Morasch,B.andMeckenstock,R.(2005).Anaerobicdegradationofp-xylenebyasulfate-
reducingenrichmentculture.Curr.Microbiol.,51(2):127–130.
Morasch,B.,Schink,B.,Tebbe,C.,andMeckenstock,R.(2004).Degradationofo-xylene
andm-xylenebyanovelsulfate-reducerbelongingtothegenusDesulfotomaculum.
181(6):407–417.,Microbiol.Arch.Musat,F.,Galushko,A.,Jacob,J.,Widdel,F.,Kube,M.,Reinhardt,R.,Wilkes,H.,
Schink,B.,andRabus,R.(2009).Anaerobicdegradationofnaphthaleneand2-
methylnaphthalenebystrainsofmarinesulfate-reducingbacteria.Environ.Microbiol.,
11(1):209.Musat,F.andWiddel,F.(2007).Anaerobicdegradationofbenzenebyamarinesulfate-
reducingenrichmentculture,andcellhybridizationofthedominantphylotype.Environ.
10(1):10–19.,Microbiol.Musat,F.andWiddel,F.(2008).Anaerobicdegradationofbenzenebyamarinesulfate-
reducingenrichmentculture,andcellhybridizationofthedominantphylotype.Environ.
10(1):10–19.,Microbiol.Nakagawa,T.,Sato,S.,andFukui,M.(2008).Anaerobicdegradationofp-xylenein
sediment-freesulfate-reducingenrichmentculture.Biodegradation,19(6):909–913.
Phelps,C.,Kerkhof,L.,andYoung,L.(1998).Molecularcharacterizationofasulfate-
reducingconsortiumwhichmineralizesbenzene.FEMSMicrobiol.Ecol.,27(3):269–279.
Rabus,R.andHeider,J.(1998).Initialreactionsofanaerobicmetabolismofalkylbenzenes
indenitrifyingandsulfatereducingbacteria.Arch.Microbiol.,170(5):377–384.

79

erencesRef8Rabus,R.,Kube,M.,Heider,J.,Beck,A.,Heitmann,K.,Widdel,F.,andReinhardt,R.
(2005).Thegenomesequenceofananaerobicaromatic-degradingdenitrifyingbac-
terium,strainEbN1.Arch.Microbiol.,183(1):27–36.
Rabus,R.,Nordhaus,R.,Ludwig,W.,andWiddel,F.(1993).Completeoxidationoftoluene
understrictlyanoxicconditionsbyanewsulfate-reducingbacterium.Appl.Environ.Mi-
59(5):1444–1451.,crobiol.Rabus,R.andWiddel,F.(1995a).Anaerobicdegradationofethylbenzeneandotheraro-
matichydrocarbonsbynewdenitrifyingbacteria.Arch.Microbiol.,163(2):96–103.
Rabus,R.andWiddel,F.(1995b).Conversionstudieswithsubstrateanaloguesoftoluene
inasulfate-reducingbacterium,strainTol2.Arch.Microbiol.,164(6):448–451.
Rabus,R.,Wilkes,H.,Schramm,A.,Harms,G.,Behrends,A.,Amann,R.,andWiddel,F.
(1999).Anaerobicutilizationofalkylbenzenesandn-alkanesfromcrudeoilinanenrich-
mentcultureofdenitrifyingbacteriaaffiliatingwiththebeta-subclassofProteobacteria.
1(2):145–157.,Microbiol.viron.EnRockne,K.,Chee-Sanford,J.,Sanford,R.,Hedlund,B.,Staley,J.,andStrand,S.(2000).
Anaerobicnaphthalenedegradationbymicrobialpureculturesundernitrate-reducing
conditions.Appl.Environ.Microbiol.,66(4):1595–1601.
Rockne,K.andStrand,S.(1998).Biodegradationofbicyclicandpolycyclicaromatichy-
drocarbonsinanaerobicenrichments.Environ.Sci.Technol.,32(24):3962–3967.
Safinowski,M.,Griebler,C.,andMeckenstock,R.(2006).Anaerobiccometabolictransfor-
mationofpolycyclicandheterocyclicaromatichydrocarbons:evidencefromlaboratory
andfieldstudies.Environ.Sci.Technol,40(13):4165–4173.
Safinowski,M.andMeckenstock,R.(2004).Enzymaticreactionsinanaerobic2-
methylnaphthalenedegradationbythesulphate-reducingenrichmentcultureN47.
240(1):99–104.,Lett.Microbiol.FEMSSafinowski,M.andMeckenstock,R.(2006).Methylationistheinitialreactioninanaerobic
naphthalenedegradationbyasulfate-reducingenrichmentculture.Environ.Microbiol.,
8(2):347–352.Seyfried,B.,Glod,G.,Schocher,R.,Tschech,A.,andZeyer,J.(1994).Initialreactionsin
theanaerobicoxidationoftolueneandm-xylenebydenitrifyingbacteria.Appl.Environ.
60(11):4047–4052.,Microbiol.Shinoda,Y.,Akagi,J.,Uchihashi,Y.,Hiraishi,A.,Yukawa,H.,Yurimoto,H.,Sakai,Y.,and
Kato,N.(2005).AnaerobicdegradationofaromaticcompoundsbyMagnetospirillum
strains:isolationanddegradationgenes.Biosc.Biotechnol.Biochem.,69(8):1483–1491.

80

Shiu,W.andMa,K.(2000).Temperaturedependenceofphysical–chemicalpropertiesof
selectedchemicalsofenvironmentalinterest.I.Mononuclearandpolynucleararomatic
hydrocarbons.J.Phys.Chem.Ref.Data,29:41.
Song,B.,Haggblom,M.,Zhou,J.,Tiedje,J.,andPalleroni,N.(1999).Taxonomicchar-
acterizationofdenitrifyingbacteriathatdegradearomaticcompoundsanddescription
ofAzoarcustoluvoranssp.nov.andAzoarcustoluclasticussp.nov.Int.J.Syst.Evol.
49(3):1129–1140.,Microbiol.Suflita,L.(2002).Detectionofanaerobicmetabolitesofsaturatedandaromatichydrocar-
bonsinpetroleum-contaminatedaquifers.Environ.Sci.Technol,36:3755–3762.
Tissot,B.andWelte,D.(1984).Geochemicalfossilsandtheirsignificanceinpetroleumfor-
mation.InPetroleumformationandoccurrence,pages93–130.Springer-Verlag,Berlin-
Heidelberg,Germany,Berlin,2edition.
Ulrich,A.,Beller,H.,andEdwards,E.(2005).Metabolitesdetectedduringbiodegradation
of13C6-benzeneinnitrate-reducingandmethanogenicenrichmentcultures.Environ.Sci.
39(17):6681–6691.,echnolTUlrich,A.andEdwards,E.(2003).Physiologicalandmolecularcharacterizationofanaer-
obicbenzene-degradingmixedcultures.Environ.Microbiol.,5(2):92.
Vogel,T.andGrbìc-Galìc,D.(1986).Incorporationofoxygenfromwaterintotoluene
andbenzeneduringanaerobicfermentativetransformation.Appl.Environ.Microbiol.,
52(1):200–202.Weelink,S.,Tan,N.,tenBroeke,H.,vandenKieboom,C.,vanDoesburg,W.,Langenhoff,
A.,Gerritse,J.,Junca,H.,andStams,A.(2008).IsolationandcharacterizationofAli-
cycliphilusdenitrificansstrainBC,whichgrowsonbenzenewithchlorateastheelectron
acceptor.Appl.Environ.Microbiol.,74(21):6672–6681.
Widdel,F.,Botius,A.,andRabus,R.(2006).Anaerobicbiodegradationofhydrocarbons
includingmethane.InDworkin,M.,Falkow,S.,Rosenberg,E.,Schleifer,K.H.,and
Stackebrandt,E.,editors,TheProkaryotes,volume2,chapter1.33,pages1028–1049.
Springer-Verlag,New-York.
Winderl,C.,Anneser,B.,Griebler,C.,Meckenstock,R.,andLueders,T.(2008).Depth-
resolvedquantificationofanaerobictoluenedegradersandaquifermicrobialcommunity
patternsindistinctredoxzonesofataroilcontaminantplume.Appl.Environ.Microbiol.,
74(3):792–801.Winderl,C.,Schaefer,S.,andLueders,T.(2007).Detectionofanaerobictolueneand
hydrocarbondegradersincontaminatedaquifersusingbenzylsuccinatesynthase(bssA)
genesasafunctionalmarker.Environ.Microbiol.,9(4):1035–1046.

81

8erencesRef

Wöhlbrand,L.,Kallerhoff,B.,Lange,D.,Hufnagel,P.,Thiermann,J.,Reinhardt,R.,and
Rabus,R.(2007).Functionalproteomicviewofmetabolicregulationin"Aromatoleum
aromaticum"strainEbN1.Proteomics,7(13):2222.

Zengler,K.,Heider,J.,Rosselló-Mora,R.,andWiddel,F.(1999).Phototrophicutilization
oftolueneunderanoxicconditionsbyanewstrainofBlastochlorissulfoviridis.Arch.
172(4):204–212.,Microbiol.

Zhang,X.andYoung,L.(1997).Carboxylationasaninitialreactionintheanaerobic
metabolismofnaphthaleneandphenanthrenebysulfidogenicconsortia.Appl.Environ.
63(12):4759.,Microbiol.

Zhou,J.,Fries,M.,Chee-Sanford,J.,andTiedje,J.(1995).Phylogeneticanalysesofanew
groupofdenitrifierscapableofanaerobicgrowthoftolueneanddescriptionofAzoarcus
tolulyticussp.nov.Int.J.Syst.Evol.Microbiol.,45(3):500–506.

82

utioncontribofExplanation9

Manuscript1.CandidatedivisionOP3cellsinlimonenedegradingmethanogenic
culturesA.-E.Rotaru,R.Schauer,C.Probian,M.MussmannandJ.Harder
EnrichmentculturesweremaintainedbyC.Probian.R.Schauerconstructedconstructed
clonelibraries,performedtheARDRAanalysisandsequencingexperiments.M.Muss-
manndesignedtheOP3-565probe.A.-E.RotarudevelopedtheconcepttogetherwithJ.
Harderandperformedthegrowthexperiment,thedesignofprobeEub-338(VI)testingof
theprobesandthequantitativecellcounts.ThemanuscriptwaswrittenbyA.-ERotaru
witheditorialcommentsofJ.Harder.

Manuscript2.Deltaproteobacteriaisolatedfromlimonenedegradingenrichments
A.-E.Rotaru,C.ProbianandJ.Harder
J.Harderinitiatedtheisolationandperformedtheprimaryisolation.A.-E.Rotaruper-
formedthesecondisolation,physiologicalexperimentsandmolecularanalysis.C.Probian
wasinvolvedintheinitialisolationandperformedsomechemicalanalysis.A.-E.Rotaru
wrotethemanuscriptwitheditorialcommentsofJ.Harder.

Manuscript3.HighlyenrichedBetaproteobacteriagrowinganaerobicallywith
nitrateand-xylenepA.-E.Rotaru,C.Probian,H.WilkesandJ.Harder

C.ProbianandJ.Harderestablishedtheenrichmentculturesandmaintainedthembe-
forethisthesiswork.A.-E.Rotarumaintainedtheculturesduringthethesisworkand
performedallthephysiologicalandmolecularexperiments.H.WilkesperformedGC-MS
analysisonmetaboliteextracts.A.-E.Rotaruwrotethemanuscriptwitheditorialassistance
.co-authorstheof

83

9

Explanation

84

of

contr

utionib

aPtr

III

uscriptsMan

85

10

uscriptMan

1

87

10

88

uscrMan

ipt

1

CandidateincellsOP3Division

enicmethanogdegradinglimonene

cultures

Amelia-ElenaRotaru§,ReginaSchauer§,ChristinaProbian§,MarcMussmann†&Jens
§Harder

§DepartmentofMicrobiology,MaxPlanckInstituteforMarineMicrobiology,Celsiusstrasse1,
ymanGerBremen,D-28359,

†DepartmentofMicrobialEcology,MaxPlanckInstituteforMarineMicrobiology,Celsiusstrasse1,
ymanGerBremen,D-28359,

Manuscriptinpreparation

89

1iptuscrMan10

AbstractThisstudydescribesforthefirsttimeamethanogeniccommunitythatbiodegradesthemost
widespreadmonoterpene,limonene.Limonenewasdegradedtomethanegas,withtransient
formationofacetate.Forabetterunderstandingofthecommunitycompositionclonelibraries
wereestablishedfortheBacteriaandArchaea16SrRNAgene.TheBacteriaclonelibrarywas
representedby16SrRNAgenesequencesrelatedtoDeltaproteobacteria,Bacteroidetesand
CandidatusDivisionOP3.Whereas,theArchaeacloneswererelatedtomembersofthegen-
eraMethanosaetaandMethanoculleus.Thecommunitycompositionoflimonenedegrading
enrichmentcultureswasanalyzedbyCARD-FISH.Duringmidexponentialgrowth40%Bac-
teriaand33%Archaeaweredetected.Aspecificprobethatwasnewlydesigned,OP3-565,
detected18%ofverysmallcoccishapedcellsthatwereobservedeithersolitaryoraggre-
gatedaroundlargercellularforms.Finally,weproposeamodeloflimonenedegradationby
syntrophicinteractionsbetweenpartners.

Keywords:limonene,monoterpene,methanogenesis,syntrophy,CandidateDivisionOP3

oductionIntrLimonene,likeothermonoterpenes,isproducedintheplastidsofplantsbyi)fusionof
twoisopreneunitstogether,catalyzedbyisoprene-synthaseandii)cyclizationcatalyzed
bylimonene-synthase(Kreuzwieseretal.,1999;Hyattetal.,2007).Thetwolimonene
enantiomers,L-andD-limonene,areproducedbydifferentplants.L-limonenehasamint
fragranceandisfoundintreesandherbs,whereasD-limoneneisfoundinthepeelsofcitrus
fruitswhereitgivesthespecificorangefragrance.Inplants,theroleoflimonene,likeother
mono-,di-andsesquiterpenoids,isthatofasecondarymetabolite(NewmanandChap-
pell,1999).Secondarymetabolitesareconsiderednon-essentialforthebasicmetabolic
functionsofplants,howevertheyestablishcomplexecologicalinteractions,fromsymbiotic
topathogenic,withmicroorganisms,fungi,insectsorhumans(Singeretal.,2003).
Thedepositionandtransportofdeadvegetationarethemajorsourcesoflimoneneand
otherterpenesinfreshwatersediments.Presently,limoneneisusedinindustryasscenting
agentintheproductionofcleaningandsterilizingproducts,orasfoodflavor.Beingoneof
thenewingredientsofdetergentsitisconsideredapotentialmarkerformodernsewage
rechargeinurbangroundwaters(Barrettetal.,1999).
Inanaerobicenvironments,suchas,undergroundwaters,anoxicsoilsoranaerobic
wastewatertreatmentplants,limoneneisdegradedintheabsenceofoxygen.Faculta-
tiveanaerobes,likeThaueraterpenicaandCastellanielladefragrans,hadbeenisolatedon
monterpenesunderdenitrifyingconditionsandbothcanthriveonlimoneneassoleenergy
source(FossandHarder,1998;Fossetal.,1998).Howeverlimonenedegradationinthe

90

absenceofelectronacceptors,wouldbethedominantprocessinanoxicsedimentswhere
thealternativeelectronacceptorswereremovedbymicrobialrespiration.Onlyfewstudies
carriedoutundermethanogenicconditionsprovedthedegradationofunsaturatedaliphatic
hydrocarbons(Schink,1985b,a;HarderandFoss,1999).
Theonlydescribedorganismcapableofunsaturatedhydrocarbondegradationunder
methanogenicconditionsistheacetyleneutilizer,Pelobacteracetylenicus.Whereasmi-
croorganismsabletodegradealkenesundermethanogenicconditionsstillawaitisolation
iption.descrandThisstudyaimstounderstandthemethanogeniccommunityestablishedinenrichment
culturesthrivingonthenaturallyubiquitousalkenoicmonoterpene,limonene.Limonene
wasutilizedasorganicenergysourcebymethanogenicenrichmentsestablishedprevi-
ouslyonα-pineneand2-carene(HarderandFoss,1999).Aftermorethen5successive
transfers,weobtainedastablecommunitycapableoflimonenedegradation.Thecommu-
nitycompositionsandstructurewasanalyzedusingthefullcyclerRNAapproach(Amann
etal.,1995).AnewlydesignedproberevealedthepresenceofmembersofCandidate
DivisionOP3(Hugenholtzetal.,1998).Thisisthefirsttimeamemberofthisphylum,had
quantified.andedvisualizbeen

methodsandMaterials

Sourceoforganismsandcultivation
Sedimentfreemethanogenicculturesgrowingondifferentmonoterpeneswereestablished
earlierwithactivatedsludgefromawastewatertreatmentplant(HarderandFoss,1999).
Theseenrichmentsweretransferredinfreshwatermethanogenicmedia(HarderandFoss,
1999)overlaidwith30ml2,2,4,6,8,8-heptamethylnonane(HMN)asinertcarrierphasefor
2%or5%limonene.Culturesweregrownin300mlmethanogenicfreshwatermediaadded
insterile500mlDuranbottles,sealedwithbutylrubberstoppers.Therubberstoppers
hadnocontacttothecarrierphasecontainingthehydrocarbon.Thehydrocarbonwas
replenishedbymoderateshaking(80rpm).Allchemicalsusedwereofanalyticalgrade.
Growthofcellswasdeterminedbyopticaldensitymeasurementsat660nmonShimadzu
.Spectrophotometer1202-VISUV

ysisanalChemicalAllsamplesforchemicalanalysisweretakenwithN2flushedhypodermicneedlesand
.ingessyrLimoneneconcentrationsweremeasuredbygas-chromatographichead-spaceanalysis
modifiedafterMusatandWiddel(2008).Gasvolumesof0.1mlwerewithdrawnat28°C
andinjectedintoa14Bgaschromatograph(Shimadzu)equippedwithaSupel-QPLOT
fusedsilicacapillarycolumn(length30m,diameter0.53mm)andaflameionizationdetec-

91

1iptuscrMan10

tor.ThecarriergaswasN2.TheGCoventemperaturewas200°Cisothermal,theinjector
wasat150°Candthedetectorat280°C.
Methanewasmeasuredbygas-chromatographyhead-spaceanalysisonthesamein-
strument,howeveratalowerGCoventemperature(110°Cisothermal).
FattyacidsweredetectedbyhighperformanceliquidchromatographyonaSykamHPLC.
Filteredsampleswerediluted1to10andsubsequentlyinjectedusingaSykamS5200
auto-sampler.SeparationwasperformedonanAminexHPX-87Hcolumn(300x7.8mm)
underisothermalconditions(40°C).Theeluentis5mMH2SO4.Fattyacidsweredetected
onanUV-Detectorat220nm.DataacquisitionandprocessingwasdonewithDataApex
ClarityHPLCSoftware(GammaAnalysenTechnikGmbH).Ourstandardsconsistedofthe
followingfattyacids:succinate,lactate,formate,acetate,propionateandbutyrate.The
detectionlimitforallofthemwas0.1mM.

Clonelibraryconstructionandanalysis

ThegenomicDNAof5mlcellculturewasextractedwiththeQUIAGENgenomictip(Quia-
gen).25nghigh-molecularweightDNAwasusedtoamplifythe16SrRNAgenewith
bacterialprimersGM3andGM4(Hicksetal.,1992;Kaneetal.,1993).Thereactionmix
consistedof2μMofeachprimer,0.2mMtotaldNTP,0.04URed-Taq-Polymeraseand1×
PCRbufferin50μl.Afteraninitialdenaturingstepof4minutesat94°C,thepolymerase
wasaddedat80°C.The32cyclesinvolvedadenaturingstepfor1minuteat94°C,primer
annealingat42°Cfor1minute,and1minelongationat72°C.TheA-overhangforcloning
wasintroducedbyafinalelongationat60°Cfor60minutes.Theampliconswerepuri-
fiedandclonedintopGEM-TEasyVectorSystemI(PromegaGmbH).Therecombinant
plasmidsweretransformedintoE.coliDH5α(Invitrogen).
Archaea16SrRNAgeneampliconswereobtainedwiththeprimerpairs21F-958Rand
21F-1492R(Stahletal.,1988;DeLong,1992)asdescribedabovewiththeannealingtem-
peratureat58°C.TheampliconswerepurifiedandclonedintopCR4-TOPOvector(Invitro-
gen,Groningen,Netherlands).Theplasmidsweretransformedintochemicallycompetent
E.coliTOP10.InsertedgeneswereamplifiedwiththevectorprimersM13FandM13R.
WeanalyzedthediversityofclonesbyamplifiedrDNArestrictionanalysis(ARDRA).PCR
productswerepurified,andaliquotsof1μgoftheamplifiedinsertweredigestedwith7.5
UoftherestrictionendonucleasesBsuRIandRsaI(Fermentas)for3hoursat37°C.The
resultingfragmentswereanalyzedonan3%agarosegels,andrestrictionpatternswithin
eachgroupweremanuallycompared.Ampliconsof16SrRNAgenesweresequenced
usinganAppliedBiosystemskitandanalyzedona3130XLGeneticAnalyser(Applied
Biosystems).SequenceswerecleanedofvectordatawithSequenceAnalysis5.2(Applied
Biosystems)andassembledintocontigswiththeSequencersoftware(GeneCodesCorpo-
ration).Thenearlycomplete16SrRNAgenesequenceswerealignedwiththeARB-Silva
softwarepackage(Ludwigetal.,2004;Pruesseetal.,2007).Amaximumparsimonyphy-
logenetictreewascalculatedexcludingtheinfluenceofhighlyvariablepositions.Thetree

92

wasreconstructedonlyusingsequenceswithover1300bp.

ProbedesignandvisualizationofcellsbyCARD-FISH
ProbeOP3-565wasdesignedforagroupof16SrRNAsequencesrelatedtoCandidatedi-
visionOP3,usingtheProbeDesigntooloftheARBsoftware(Ludwigetal.,2004;Pruesse
etal.,2007).Theaccessibilityoftheprobewasverifiedbyinspectionofthetargetsites
ontheRhodopirellulabaltica16SrRNAaccessibilitymap(Behrensetal.,2003).Insil-
icotestingwasdoneagainsttheRDPIIdatabasevs.9.48(http://rdp.cme.msu.edu/
probematch/search.jsp).OP3565showedinsilico,1.2weightedmismatchestoThial-
kalivibriohalophylus(DSM15791)andMarinitogapiezophila(DSM14283).Therefore,an
equimolarmixofthesetwoorganismswasusedascontrolforhybridizationexperiments.
Probesweresynthesizedwithahorseradishperoxidase(HRP)modificationatthe5’-end
(http://www.biomers.net)andusedforhybridizationexperiments.
HybridizationexperimentswereperformedwithCARD-FISH,amethodadaptedfrom
Pernthaleretal.(2002).Sampleswerefixedwith1%paraformaldehyde,washedinster-
ilewaterandfilteredon0.2μmGTTPfilters.Filterswereembeddedin0.2%lowmelting
pointagarose(Metaphor)toensureaminimalcellloss.Driedfiltersweredehydratedwith
96%ethanolpriortopermeabilization.Wepermebilizedfor1hourat37°Cusing10mg/ml
lysozymein0.1MTris-HCland0.05MEDTA.Thesecondpermeabilizationstepwasin0.1
MHClfor30sec.Toinactivateendogenousperoxidases,weperformedanotherincubation
stepfor10minin0.01MHCl.Hybridizationswerecarriedoutfor4hoursat46°Cwithvar-
iousformamideconcentrationstoensureprobespecificity(seeTable1).Theratioofprobe
tohybridizationbufferwasof1to300.Washingwasperformedat48°Cfor10min.Bothhy-
bridizationbufferandwashingbufferwerepreparedasdescribedbefore(Pernthaleretal.,
2002).Filterswerebroughttoequilibriumin1xPBSfor20minpriortosignalamplification.
Thesignalwasamplifiedfor20mininthedarkat46°CwithAlexa594labeledtyramides.
Allsampleswerecounter-stainedwithDAPI1μg/mlasreferenceforrelativecellcounts.

Results

Enrichmentofmethanogeniccultureswithlimoneneassubstrate
Inthisstudy,weshowedforthefirsttimetheabilityofmethanogenicenrichmentcultures
togrowonlimonene.Allculturesweretransferredannually.Withinthistime,300mlculture
producedmorethen1Lofgas.Smallamountsofacetate(2mM)andcysteine(1mM)were
supplementedtothefreshwatermedia,tosustainthemethanogeniccommunity.However,
bothcompoundscouldbeusedasalternativeenergysourcesbyadifferentorganismsfrom
acomplexmicrobialcommunity.
Wemonitoredtheconsumptionoflimoneneandproductionofmethanegasincultures
withorwithoutadditionalacetate(2mM)forcirca7months(Figure10.1).Weobserved

93

1iptuscrMan10

aclearincreaseincelldensityaftermorethen2months.Themaximumcelldensitywas
measuredafter6monthsinenrichmentcultureswithadditionalacetate(Figure10.1A).
Limonenedecreaseoccurredafter4monthsinenrichmentcultureswhereassterilecontrols
didnotshowadecrease(Figure10.1B).Themethaneproductionwasdifferentbetween
culturesincubatedwithorwithoutadditionalacetate.Thecultureswithacetate,showed
asteadyincreaseofmethanefortheentireincubationperiod,whereascultureswithout
additionalacetate,startedmethaneproductionwithadelayof3months(Figure10.1C).
Acetatebuildupwasobservedwithinthefirst3monthswithasuddendecreaseduringthe
4thmonth(Figure10.1A).Forcultureswithadditionalacetate,weobservedthatfattyacids
didnotaccumulateattheendoftheincubationwhereasthe2mMacetatesupplemented
tothemediawasconsumed,aswell.
Thestochiometrywascalculatedfortwocultureduplicates(series164and165)incu-
batedwithdifferentamountsofmonoterpeneinthepresence(165)orabsence(164)of2
mMacetateasshowninTable10.2.Themethaneproducedinacontrolexperimentwithout
limonene,matched(97%methanerecovery)thetheoreticalmethaneproducedby2mM
acetateand1mMcysteine.Moreover,thiscontrolcultureproduced90%lessmethane
whencomparedtotheleastactiveenrichment.Inenrichmentculturesthemethanerecov-
erywasbetween45%and75%fromthetheoreticalmethanethatcouldbeformedfromthe
totalamountoflimoneneutilizedandotherenergysourcesadded(acetate,cysteine).Our
datasupportthefollowingstoichiometry:C10H16+6H2O→7CH4+3CO2

compositionunitycommobialMicrThemicrobialcommunitycompositionsoflimonenedegradingenrichmentswasrevealed
bythefullcycle16SrRNAapproach(Amannetal.,1995).Weestablishedclonelibraries
forBacteriaandArchaea16SrRNAgenes.ARDRAanalysiswasperformedon327Bac-
teriaclonesand141Archaeaclones.TherepresentativeclonesforeachARDRApattern
weresequenced.Phylogeneticanalysiswereperformedwith34Bacteriaand28Archaea
representative16SrRNAalmostfulllengthsequences.Moreover,wepartiallysequenced
141Archaeaclonesand130Bacteriaclones.16SrRNAgenesequenceswithmorethen
98.5%identitywereregardedasoneOTU.The21OTUrepresentativesforBacteriaand
Archaeaandtheirclosestculturedandunculturedrelativesareshownintable10.3.

BacteriaclonelibraryBacteria16SrRNAgenesequenceswererepresentedby11
OTUs(Table10.3)relatedtoBacteroidetes(i),Deltaproteobacteria(ii)CandidateDivision
OP3(iii)andaswellFirmicutes(iv)(Figure10.2).
(i)Bacteroidetes.AllsevenBacteroidetesOTUswerefarrelatedtoProlixibacterbellari-
ivorans(81to89%identity)andAlistipesputredinis(84.1%).Clonesfromalongchainfatty
acid(LCFA)degradingenrichmentshowedhighsimilaritywithmostofourBacteroidetes
sequences(92-96%identity).OtherBacteroidetesOTUshadveryhighsimilarity(≥99%)
tosequencesretrievedfromwastewaterofpapermilorcokingtreatmentplants.Some

94

Bacteroidetessequencesshowedlessthen90%sequenceidentitytounculturedmicroor-
ganismsfrombiofilmsofanacidminedrainageorsequencesretrievedfromthechimney
ofahydrothermalvent.
(ii)Deltaproteobacteria.ThetwoidentifiedDeltaproteobacteriaOTUswererelatedto
Syntrophobactersp.witha16SrRNAidentityofonly92%.Theirunculturedrelatives
whosesequenceswereretrievedfromLCFAmethanogenicenrichmentsandsphagnum
peatbogsamplesshowed4.9%differenceinsequenceidentity(Table10.3).
(iii)CandidateDivisionOP3.Interestingly,oneOTUrepresentedby5sequences,was
veryfarfromanythingcultureduntilnow,showingasmuchas24.2%differencetothe
closestculturedrelative,Opitussp.VeSm13,fromphylumVerucomicrobia.Moreover,this
phylotypeshowedevenalow16SrRNAgeneidentity(16.7%different)tomembersofthe
unculturedphylum,CandidateDivisionOP3(Table10.3).
(iv)Firmicutes.OurBacteriaclonelibraryrevealedalsothepresenceofoneFirmicutes
phylotype.Thissequencehad91.2%identitytoSyntrophomonassp.,andonly95%tothe
closestunculturedrelative,asequenceretrievedfromareactordegradingorganicwaste.

ArchaeaclonelibraryArchaea16SrRNAgenesequenceswererepresentedby10Eu-
ryarchaeotaOTUs(Table10.3),relatedtomicroorganismsfromtheordersMethanomicro-
biales(v)andMethanosarcinalles(vi)(Figure10.3).
(v)Methanomicrobiales.Withoneexception,allMethanomicrobialessequenceswere
comprisedinoneOTU,whichshowed91.6%identitytoMethanoculleussp.Theother
MethanomicrobialesOTUwasfarrelated(88.6%)toamemberofthesamegenus,namely
palmolei.M.(vi)Methanosarcinalles.TheorderMethanosarcinalleswasrepresentedby8OTU,which
wereverysimilaroridenticaltothe16SrRNAgeneofMethanosaetasp.AMPB-Zg(more
then99%identity)andMethanosaetaconcilii(89%to100%identity)(Table10.3).

Catalyzed-reporter-depositionfluorescentinsituhybridization
Byphasecontrastmicroscopyweidentifieddifferentmorphotypesfromlongandthickfila-
mentstothinfilaments,vibrio,andcocciofdifferentsizes(Figure10.4GandH).Tobetter
understandthecommunitycomposition,wequantifiedthemembersofthiscommunitywith
CARD-FISHduringmidexponentialgrowth,inculturesthrivingonlyonlimonene(without
acetate).additionalKingdomspecificprobing.TheEubacteriageneralprobe,Eub-338(I),matchedinsil-
icomostsequencesfromourBacteriaclonelibrary,withtheexceptionofCandidateDivi-
sionOP3phylotype.ThisphylotypedidnotmatchinsilicoanyotherpublishedEubacteria
probes(Eub-338IIandIII).ThereforewedesignedanewEubacteriaprobe,Eub-338(VI),
whichperfectlypairedpositions338-355onthe16SrRNAgeneofCandidateDivisionOP3
sequences.Thesetwoprobeswhenappliedinequimolaramount,targeted40%ofthetotal
cells(DAPIstained)ofthemicrobialcommunity.TheArchaeaprobe,Arch-915,matched

95

1iptuscrMan10cellswithinMethanosaeta-likefilamentsandrodswithflatends,thatmadeupfor33%of
theentiremicrobialcommunitydetectedbyDAPI.Thereforecirca26%oftheDAPIstained
cellswerenotdetectedwithHRP-labeledprobes(Table10.4).Weobservedthatthegen-
eralArch-915didnottargettheentireMethanosaeta-likefilamentsbutratherscarcecells
throughthefilaments(Figure10.4C).Therelativepercentagesofprobetargetedcellsver-
susDAPItargetedcellsareshowninTable10.4.AscontrolprobeweusedNon-338,which
gaveonesignalforeach300DAPIstainedcells.
Groupspecificprobing.ToidentifythegroupswithinBacteriaandArchaea,whichdom-
inatetheenrichments,groupspecificprobeswereapplied.(i)Bacteroidetes.ProbeCF-
319amatchedinsilicoalltheBacteroidetessequencesfromourclonelibrary.However,it
stainedonly1%ofthetotaldetectedcellsintheenrichmentsamples.(ii)Deltaproteobac-
teria.ProbeDelta-495a,targetedinsilicoalltheDeltaproteobacteriasequencesfromthe
Bacteriaclonelibraryandstained12%ofthetotalcells,whichcorrespondstolessthen
onethirdoftheEubacteria(Eub-338I&VI).(iii)CandidateDivisionOP3.TheCandidateDi-
visionOP3probe(OP3-565)designedduringthisstudy,wasusedtovisualizeandquantify
forthefirsttimeCandidateDivisionOP3members.Thisprobestainedverysmallround
cells(Figure10.4EandFforthecorrespondingDAPI)whichmadeupfor18%ofthetotal
DAPIstainedcells,thatrepresentsalmosthalfofthetotaldetectedEubacteria.Whenthe
probewasappliedatthesamehybridizationconditionson1.2weightedmismatchcontrol
organisms,MarinitogapiezophilaandThialkalivibriohalophylus,itdidnotbind.Todou-
blecheckthepresenceandquantityofCandidateDivisionOP3,weusedprobePla-46,a
Planctomycetespecificprobe,whichmatchedinsilicoourCandidateDivisionOP3phylo-
type.Whenapplied,thisprobestainedthesamemorphotypelikeOP3-565,butmatched
only13%ofthetotaldetectedcells.(vi)Methanosaetaceae.Sinceinourenrichmentswe
foundnumerousfilamentswithaMethanosaetalikemorphology,weexpectedthatthese
phylotypewillberepresentativeforArchaea.ProbeMX-825isspecificforsomemembers
oftheMethanosaetaceaefamily,andmatchedinsilicoalltheMethanosaetaphylotypes
fromtheArchaeaclonelibrary.However,whentestedonourenrichmentculturesitonly
targeted1%oftheDAPIstainedcells,thatcorrespondstoabout3%oftheArch-915de-
tectedArchaea.MX-825didnottargettheentirefilamentsbutratherscarcecellsthrough
thefilamentsasobservedearlierwiththegeneralArchaeaprobe,Arch-915.

DiscussionsEnrichmentculturesthrivingonlimoneneundermethanogenicconditions
Inthisstudy,wedemonstrateforthefirsttime,limonenedegradationundermethanogenic
conditions.WhentheonlyelectronacceptorleftisCO2,microorganismscangainonlyvery
smallamountsofenergyfromlimonenecomparedtootheranaerobicrespiratoryprocesses
withelectronacceptorslikenitrate,ironorsulfate.Tosurpasstheenergeticbarriers,mi-
croorganismsestablishmutualisticco-operations.Suchinteractionsbetweenmicrobes,are

96

dependentontransferofintermediarymoleculeslikehydrogen,formateoracetatebetween
metabolicallydifferenttypesofmicrobes(SchinkandStams,2006).Theoreticalcalcula-
tionsonlimonenedegradationinmethanogenicconditionsweredoneafterMavrovounio-
tis,1991.Thisisanenergygainingprocess,withafreeenergygaininstandardconditions
(ΔG0’)of-348kJoulemol−1limoneneconsumed.Undermethanogenicconditionsdifferent
metabolicgroupscouldsharethefreeenergyreleasedbythemineralizationoflimonene.
Wesuggestamodelforthedegradationoflimonenewithafirstgroupofmicrobes,most
likelyfermentingbacteria,capableoflimonenedegradationtoalcoholsandfattyacids.
Syntrophicmicroorganismswouldbreakdownshortchainfattyacidsandalcoholstosmall
moleculeslikeacetate,formate,hydrogen,orcarbondioxide.Thesecouldbeusedas
substratesbymethanogens,whichproducemethaneandcarbondioxideasend-product.
Inourenrichmentsitismorelikelythatacetateisexchangedbetweensyntrophicbacteria
andmethanogenicArchaea.Thiswassuggestedbyacetateformationandconsumption,
inculturesincubatedwithlimoneneasorganicenergysource(withoutanyadditionalac-
etate).Theadditionandaccumulationofacetatewasreportedtoinhibitsyntrophicdegra-
dationoffattyacidsandbenzoate(AhringandWestermann,1987;Fukuzakietal.,1990;
Warikooetal.,1996).Henceitispossiblethatlargeramountsofacetatecouldhavean
„end-metabolite“inhibitoryeffectonthesyntrophicmicrobialcommunity,andfinallyonthe
limonenedegradationprocessitself.
Acetateandhydrogenreleasingreaction:
C10H16+10H2O→5C2H4O2+8H2
ΔG0’=+156kJoulemol−1limonene

Acetateandhydrogenconsumingreactions:
C2H4O2→CH4+CO2
ΔG0’=-49kJoulemol−1acetate
4H2+CO2→CH4+2H2O
ΔG0’=-131kJoulemol−1methane

otal:TC100H16+6H2O→7CH−41+3CO2
ΔG’=-348kJoulemollimonene

compositionunitycommobialMicrTobetterunderstandthemicrobialcommunitycompositioninlimonenedegradingenrich-
ments,weusedthe16SrRNAapproach.Thisculture-independentapproachrevealedthe
presenceofunusualphylotypesspanningthroughthesuper-kingdomsofBacteriaandAr-
chaea.CARD-FISHwaspreferredtothemoreusualmono-labeledFISH,tosurpassthe
differencesincellmetabolicactivities,orthevarietiesofmicrobialcellwallsthatsucha
complexcommunitymighthave.Kingdomspecificprobesaccountedfor73%ofthetotal

97

1iptuscrMan10DAPIstainedcells,whichcouldbedueto:i)anunevenpermeabilizationtreatmentofthe
differentcelltypespriortohybridization,ii)deadcellswithinMethanosaeta-likesheaths,
supportedbyphasecontrastvisualizationofMethanosaeta-likeemptysheathstretches,
andiii)theexistenceofotherunknownphylasinourenrichmentswhicharenottargeted
bytheknownphylogeneticprobesandprimers.ArecentstudyshowedthatMethanosaeta
conciliigivesheterogeneoussignalsindependentofthedifferentpermeabilizationproce-
durespriortoCARDhybridizations.Theyobservedadoublinginthedetectionratesof
Archaeaafterprolongingthestorageofthesamplesfrom2weeksto6months(Kubota
etal.,2008).Sinceoursampleswereusedoneortwodaysafterfixationandpermeabi-
lizationwemighthaveunderestimatedtheabundanceofArchaea.
AlltheBacteriaphylotypesrecoveredfrommethanogenicenrichmentcultureswerephy-
logeneticallydistantfromanydescribedgenuswithinthefamiliesBacteroidetes,Deltapro-
teobacteria,orFirmicutestowhichtheywereascribed.Whereasoneoftheencountered
phylotypeswasrelatedtosequencesofmicroorganismsfromtheunculturedphylum,Can-
OP3.DivisiondidateBacteroidetes.PhylumBacteroidetesishighlydiverseandlatelythetaxonomyofthis
phylumwentthroughnumerouschanges,suchasreclassificationofmembersofgenus
Bacteroidesasmembersofanovelgenus,Alistipes(Rautioetal.,2003).GenusAlis-
tipesisrepresentedbystrictlyanaerobicmicroorganisms,isolatedprimarilyfromhuman
sources,whichhaveasmajormetabolicproductsuccinate(Rautioetal.,2003;Songetal.,
2006).InourBacteriaclonelibrary,wefoundtwophylotypesrelatedtoA.putredinis.Differ-
encesin16SrRNAidentityof16%to18%suggeststhatthesesequencesbelongtoanew
genus,withinfamilyRikenellaceae,.TheotherBacteroidetesphylotypesfoundinoursur-
vey,wererelatedtoProlixibacterbellariivorans,withidentitydifferencesrangingbetween
12%and16%.GenusProlixibacterisrepresentedbyfacultativeanaerobes,whichferment
sugarsbymixed-acidfermentation(Holmesetal.,2007).Themembersofthisphylumwere
notinsignificantnumbers(1%),asobservedbyhybridizationexperimentswithCF-319a.
Bacteroidetesrelatedorganismscouldbeinvolvedindegradationoflong-chainfattyacids,
aspartoftheprocessoflimonenedegradation,orascavengersofresidualorganicmaterial
.cellsdeadfromDeltaproteobacteria.ThetwonewDeltaproteobacteriaphylotypes,foundduringoursur-
vey,wererelatedtothenon-syntrophicSyntrophobactersp.strainTsuA1(92%),asulfate
reducerwhichgrowsonadipateandisabletoutilizeC1-C12straightfattyacids,C2-C10
straightchainprimaryalcohols,2-,3-hexadionate,pyruvate,andlactate(Tanakaetal.,
2000).However,theseSyntrophobacter-relatedphylotypes,wereonlyfarrelatedtothis
sulfate-reducer,andshowedevenlargerdifferencestosyntrophicmicroorganismsofthe
familySyntrophobacteraceae.Thereforewesuggesttheyrepresentanovelgenuswithin
theclassDeltaproteobacteria.Syntrophobacter-relatedorganismstogetherwithCandidate
DivisionOP3-relatedmicroorganismsmadeupforalmosttheentireBacteriadetectedin
thissurvey.
CandidateDivisionOP3.SequencesofCandidateDivisionOP3wereidentifiedand

98

groupedwithinonephylotype.Thisphylotypewaswellrepresentedinourenrichmentcul-
tures.SmallandroundshapedcellsweretargetedbythespecificOP3-probe,andwere
foundeitheraloneorattachedtoalargercellwhichwasnotstainedbytheOP3spe-
cificprobe.16SrRNAsequencesofCandidateDivisionOP3havebeenhithertorecovered
solelyfromanoxichabitatssuchastheanoxicsedimentsofYellowstoneHotSpring(Hugen-
holtzetal.,1998),theanoxicwaterbodyoftheCariacobasin(Madridetal.,2001),700
mdeepintheAntarcticcontinentalshelf(BowmanandMcCuaig,2003),groundwaterofa
goldmine(Linetal.,2006),15mdeepinapristinecoastalaquifer(Lopez-Archillaetal.,
2007)orfromananaerobicwastewaterdigestor(Chouarietal.,2005).Sincethereisno
isolateavailable,theirmetaboliccapabilitiesareunknown.Wecouldonlysuspectthatthey
mightbeinvolvedinshortchainfattyaciddegradation,consideringthatOP3sequences
werefoundalsointwoanaerobicandmesophilicchemostatsthrivingonpropionateand
butyrate(Shigematsuetal.,2006;Tangetal.,2007).

ThemethanogenicArchaeainlimonenedegradingenrichmentswere33%oftheentire
community,andwererepresentedbymembersofthegenusMethanosaetaandMethano-
.culleus

Methanosaeta.MostoftheMethanosaetaphylotypesfromourArchaeaclonelibrary
werecloselyrelatedtomembersofgenusMethanosaeta(90%to100%sequenceidentity).
Thisgenuscomprisesobligateanaerobeswhichuseassoleenergysourceacetate,con-
vertingitintoequimolaramountsofmethaneandcarbondioxide.ThetwoMethanosaeta
relativeswereMethanosaetaconciliiwhichwasisolatedfromapearwastedigestor(Pa-
telandSprott,1990)andMethanosaetasp.AMPB-Zgisolatedfromfreshwatersediment
(ScholtenandStams,2000).Bothweredescribedassheathedrodsthataggregateinto
bundles.WeidentifiedsuchfilamentswithaMethanosaetaceaespecificprobe,MX-825,
thattargetedinsilicoalltheMethanosaetaphylotypesfromourArchaeaclonelibrary.How-
everwhenappliedthisMethanosaetaceaeprobestainedonly1%ofthetotalcellsfromour
limonenedegradingenrichment.BoththeMethanosaetaceaespecificprobe,MX-825,and
theArchaeaprobe,Arch-915,stainedfilamentsheterogeneouslyaspreviouslymentioned
forM.concilii(Kubotaetal.,2008).

Methanoculleus.TheclosestMethanoculleusrelativefortwoofourphylotypeswas
Methanoculleuspalmolei(Zellneretal.,1998)ahighlyirregularcocci,isolatedfroman
anaerobicbioreactortreatingwastewaterofapalmoilmill.M.palmolei,likemostmem-
bersofgenusMethanoculleus,hascomplexnutritionalrequirementssuchaspotassium
andtungstenionsasgrowthpromoters,oracetateasorganicmineralsupplement(Zellner
etal.,1998;Whitmanetal.,2006).Inincubationoflimonenedegradingenrichmentswith-
outsupplementaryacetate,weobservedalongerperiodpriortomethanebuild-upbecause
thisgroupofmethanogensislikelyout-competed.

99

1iptuscrMan10

lusionsConc

Limonenedegradationundermethanogenicconditionsrevealedacomplexsyntrophiccom-
munityspreadthroughtheBacteriaandArchaeakingdoms.Limoneneismostlikelyde-
gradedbyBacteriatoacetate,thatisfurtheronmetabolizedbymethanogenicArchaea,to
methaneandcarbondioxide.WeidentifiedunusualBacteriaphylotypes,whichcouldbe
representativesofnovelgenuswithinRickenelaceae,andSyntrophobacteraceae.Wevisu-
alizedandquantifiedmembersofthehithertounculturedCandidateDivisionOP3,whose
smallroundcellsoftenattachtothesurfaceofotherbacteria.
Thisenrichmentscontaineduniquephylogeneticnoveltythatcouldbetheobjectiveof
moreindepthmolecularandphysiologicalanalysis.Wesuggest:i)theuseofametage-
nomicapproachforadditionalinformationonCandidateDivisionOP3members,ii)theuse
ofamoresophisticatedecologicalapproach,Nano-SIMS,toidentifythephylogenyofthe
microorganismdegradingC13-labeledlimonene,iii)orisolationofthelimonenedegrading
organismsinwelldefinedco-cultures,usingliquidandsoliddilutionseriesinthepresence
ofanacetotrophicorhydrogenotrophicmethanogen.

wledgmentsknoAc

WethanktheMaxPlankSocietyandtheInternationalMaxPlanckResearchSchoolfor
MarineMicrobiologyforfinancialsupport.

100

Figures

Figure10.1:

lestaband

Limonenerdegadationinotwenrichmentculturesincubatedinthepresence(filledsymbols)orabsence(openedsymbols)ofacetate(2mM)undermethanogenicconditions.PanelAshowstheopticaldensityincreaseinthe
twoenrichmentcultures,growingwith5%(filledcircle)and2%(openedcircles)limoneneinHMN.Thereisa
transientaccumulationofacetateinenrichmentculturesincubatedonlywithlimonene(emptysquares).Panel
Bshowstheconsumptionoflimoneneinthesameenrichmentcultures,with5%(filleddown-triangles)and2%
(emptydown-triangles)limoneneinHMNversusincubatedcontrolswithoutinocula(correspondingfilledand
emptyup-triangles).InpanelCisshownthemethaneproductioninenrichmentcultures(correspondingfilled
andemptyhexagons)versusaninoculatedcontrolwithacetate2mM(filleddiamonds).

101

10

1iptuscrMan

10.2:Figure

102

MumaximyparsimontreeofBacteria16SrRNAgenesequencesretrviedefromlimonenerdegadingmethanogenicenrichmentcultures.TherepresentativeBacteriasequencesobtainedinthisstudyareempha-

sizedinboldletters.Theaccessionnumberofreferencesequencesisshowninparentheses.Crenarchaeota

sequenceswereusedasout-group.Thescalebarcorrespondsto10substitutionsper100nucleotides.

Figure

10.3:

MumaximyparsimontreeofArchaea16SrRNAgenesequencesretrviedefromlimonenerdegadingmethanogenicenrichmentcultures.TherepresentativeArchaeasequencesobtainedinthisstudyareempha-

sizedinboldletters.Theaccessionnumberofreferencesequencesisshowninparentheses.Crenarchaeota

sequenceswereusedasout-group.Thescalebarcorrespondsto10substitutionsper100nucleotides.

103

1iptuscrMan10

10.4:Figure

104

Microscopicimagesofsamplesfrommethanogenicenrichmentculturesthrivingon,limonenesaedvisualizybepifluorescencemicroscopy(A-F)andphasecontrastmicroscopy(GandH).Theleftpanelsrepresentsamples
stainedbydifferentHRPlabeledprobes.TheredsignalsaregivenbytheHRPcatalyzeddepositionofAlexa-
594tyramides.TotherightarethesamesamplesvisualizedbyaDNAstain,DAPI.PanelAshowscellsstained
bythegeneralEubacteriaprobes,Eub-338(IandVI).Thesamemicroscopicfieldisshowntotheleft,inpanel
B,withcellsonlystainedbyDAPI.InpanelCareshownArch-915stainedcells.Thecorrespondingmicroscopic
fieldvisualizedwithDAPIisshowntotheright,inpanelD.PanelE,depictscellsstainedwiththenewlydesigned
probe,OP3-565,specificfortheCandidateDivisionOP3phylotypefromtheBacteriaclonelibrary.Totherightis
thesamemicroscopicfieldvisualizedbyDAPI.Thetwophasecontrastmicroscopicimages,showanaggregate
(panelG)andtheusualmorphotypes(panelH)encounteredinlimonenedegradingenrichmentcultures.The
scalebaris5μmforallimages.

limoneneonivingthrculturesichmentenrfromsamplesonapplied,probeslabeledHRPybmineddeterascompositionunitycommMicrobial.conditionsmethanogenicunder
T10.1:elba

erencesRef-mramideFo

siterRNAtarget16S

(5’-3’)SequencenameProbe

%)agerev(coroupgargetT

199119931990a19941996Amann,19982002al.,al.,al.,al.,etal.,etetal.,studyandstudyetettallnereRaskinAmannStahlManzyThisThisNeefWLo0-35%30%35%0-35%50%0-35%30%30%35%

319-336915-934338-35546-63825-847-338-355565-583495-512

GCCGGTGCTTCCTAGTTADelta-495a**(73%)CAGTTGGTCCGTGTCTCACF-319a(38%)CCTCACCGTGGCCGATCGCAMX-825members)(someCGA
GTGGAAGCTGCCTCCCGTEub-338*(90%)TTCCTGTGCTCCCCCGCCAAArch-915(90%)
DomainGTGGAAGCCTCCCGTGCA(VI)*Eub-338OP3torelatedLiMClonesDomainGCGGCACGGGAACTCCTANon-338NoneiaDeltaproteobacterClassylumPhTCCAATGCCTCTTGCAGAPla-46(75%)ycetaceaePlanctomamilyFamilyFCCCACACCTGCCCTTTATOP3-565OP3torelatedLiMClones
MethanosaetaceaeiaBacteroidetesArchaeaBacter

ia.Deltaproteobacteria.BacterawEub-338(VI)andEub-338probesofamountequimolar*Anateumerentoappliedsthetargettousedasw3’)GCCGGTGCTTCTTAGTTA(5’competitorandDelta-459aprobeofamountequimolar**An

105

1iptuscrMan10

106

×2H4O2→CH4+CO2andatedconcentramount.mentionedtheinmediathetoaddedsuspensioncell
ii)4C3H7NO(aluevtheoreticalthetorelationinculturesybproducedmethaneofpercentagetheiseredvrecomethane***The02sawinocula**TheCi)equations:thefromcalculatedcysteandacetatefrommedrofmethanetheoreticaltheWhereas1.equationtoaccordingcalculatedsawlimonenefrommedrofmethanetheoreticalThe*
2S+H2O→5CH4+7CO2+4NΣHCH32.elyrespectiv,S
4cysteine).andacetatelimonenefrom+4H
inewas

Inoculav/v)(%limonene(mmol)Initiallimonene(mmol)Final--0.1--**1.3l164Ctr-0.3500.3-15.48.22.44.6**1.3164B650.3-14.09.72.64.6**1.3164A970.30.6-0.9--01l165Ctr450.30.625.912.06.31010165B750.30.615.412.37.81010165AnameCulture
methane(mmol)FinalMethane(T)Limonene(mmol)from:(T)Acetate(T)CysteinerecoMethane(%)***very

lbaT10.2:e
media.thetoinocula,thewithiedcarrsourcescarbonendogenousthetorelatedisaddedacetateofacestrthetoorproducedmethanetheofuchmwohdewshol)(CtrculturesControl(2mM).acetateofacestrofabsenceorpresencetheinlimonenewithculturesichmentenrinproductionmethaneandconsumptionLimonene

.esrelativunculturedandculturedsest
DENTITY(%)I96.5(AB021306)MGB-C1ainstrs
SyntrophomonaIVETRELATUREDNCULU
96.5(AB244309)cultureichmentenrmethanogenicALCF88.7Y918928)(A99.7Y426460)(AaterwastewmillpaperbioreactorAnaerobic85.3Y918928)(A92.5(AB244309)cultureichmentenrmethanogenicALCF86.9Y918928)(A88.1Y082469)(AbiofilmainagedrmineacidaceSubsurf83.9Y918928)(A99.5(DQ988269)aterwastewcokingBiofilm86.5Y918928)(AibedUndescr96.3(DQ288691)99.0(AB236066)sedimentondP91.6(Y16382)96.4(AB236066)sedimentondP88.7(Y16382)98.8Y454768)(AsedimentsineestuarropicalT95.0(X16932)92.5(AF126838)angyoSeLakofSediments95.2(X16932)98.0(AB355101)eLakManzallahaterwaceSurf97.6(X16932)98.8Y454768)(AsedimentsineestuarropicalT98.1(X16932)91.9(AF126865)angyoSeLakofSediments89.8(X16932)100.0Y835819)(AsludgeularnargAnaerobic100.0(X16932)
99.3(EU214534)vironmentenadingrdegDCM84.1(L16497)malydrotherhdeep-seaeInactiv81.8(L16497)83.8(AB100013)yschimneentv
92.3(AF524857)bogpeatumsphagnMethanogenic92.1(AJ237605)Tsu1ainstr.sp95.1(DQ459216)cultureichmentenrmethanogenicALCF92.4(AJ237605)Tsu1ainstr.spvreseroilleadabrbiodegaturew-temperLo99.7(AJ276397)AMPB-Zg.sp99.7Y570672)(Aoir99.8(AB266919)ulesnargsludgeASBU99.8(AJ276397)AMPB-Zg.sp
83.3(AF507707)soilorestfPinion-juniper75.8(X99392)eSm13V.sp
DENTITY(%)Iclotheirot)%.(IDidentitytheand,conditionsmethanogenicunderwingorgculturesichmentenradingrdeglimoneneinidentifiedTUs)(OylotypesPh.parenthesisinengivisorganismserencereftheofumbernaccessionTheHYLUMPiaProteobacteriaProteobacterBacteroidetesBacteroidetesBacteroidetesBacteroidetesBacteroidetesBacteroidetesBacteroidetesmicutesFir5LiM-11E9OP3DivisionCandidatearchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEur
TIVERELATUREDULSyntrophobacterSyntrophobacteransoriivbellarProlixibacteransoriivbellarProlixibacterputredinisAlistipesansoriivbellarProlixibacteransoriivbellarProlixibacteransoriivbellarProlixibacterputredinisAlistipescellicolaSyntrophomonasOpituspalmoleiMethanoculleuspalmoleiMethanoculleusMethanosaetaMethanosaetaconciliiMethanosaetaconciliiMethanosaetaconciliiMethanosaetaconciliiMethanosaetaconciliiMethanosaetaconciliiMethanosaeta
.CONLONEC11LiM-14A121LiM-13G98LiM-14F63LiM-14D122LiM-11A121LiM-14G101LiM-14B61LiM-15G71LiM-15A31LiM-15G510LiM-3B2F1LiM-3B9C5LiM-2A5C4LiM-2A5D2LiM-2B6E2LiM-2A4A1LiM-3B6F1LiM-3B2H1LiM-2B7A1LiM-2B6H
baT10.3:el

Y918928)(AY918928)(A(AY918928)Y918928)(AY918928)(A(DQ288691)(Y16382)(Y16382)
(AJ237605)Tsu1ainstr.sp.sp(AJ237605)Tsu1ainstr(AJ276397)AMPB-Zg.sp(AJ276397)AMPB-Zg.sp
(L16497)(L16497)(X16932)(X16932)(X16932)(X16932)(X16932)(X16932)
(X99392)eSm13SyntrophobacterSyntrophobacteransoriivbellarProlixibacteransoriivbellarProlixibacterputredinisAlistipesansoriivbellarProlixibacteransoriivbellarProlixibacteransoriivbellarProlixibacterputredinisAlistipescellicolaSyntrophomonasOpituspalmoleiMethanoculleuspalmoleiMethanoculleusMethanosaetaMethanosaetaconciliiMethanosaetaconciliiMethanosaetaconciliiMethanosaetaconciliiMethanosaetaconciliiMethanosaetaconciliiMethanosaeta
V.sp

511LiM-14A121LiM-13G98LiM-14F63LiM-14D122LiM-11A121LiM-14G101LiM-14B61LiM-15G71LiM-15A31LiM-15G510LiM-3B2F1LiM-3B9C5LiM-2A5C4LiM-2A5D2LiM-2B6E2LiM-2A4A1LiM-3B6F1LiM-3B2H1LiM-2B7A1LiM-2B6H
LiM-11E9

iaProteobacteriaProteobacterBacteroidetesBacteroidetesBacteroidetesBacteroidetesBacteroidetesBacteroidetesBacteroidetesmicutesFirOP3DivisionCandidatearchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEurarchaeotayEur

107

1iptuscrMan10

108

Table10.4:RelativeabundanceofdifferentgroupsofBacteriaandArchaeainmethanogenicen-
richmentculturesthrivingonlimoneneasquantifiedbyCARD-FISH.

%population*hybridizedwith:
ProbeTargetKingdomspecificPhylumorgroup
probesspecificprobesEub-338(I&VI)Eubacteria40-
-0NonsenseNon-338-33ArchaeaArch-9152-1iaDeltaproteobacterDelta-495a-1BacteroidetesCF-319a**13-ycetesPlanctomPla-46OP3-565CandidateDivisionOP3-18
-1MethanosaetaMX-825Totalrecovery7332
*NumbersshowthepercentagesofcellsthathybridizedtoaprobeversusDAPI-stainedcellsinthesame
visualfield.**ThisprobewasusedtotargetCandidateDivisionOP3,sinceinsilicoitfullymatchedourOP3
sequences.Thereforeweexcludedthe13%Pla-46targetedcellsfromthetotalrecovery.

erencesRefAmann,R.,Ludwig,W.,andSchleifer,K.(1995).Phylogeneticidentificationandinsitu
detectionofindividualmicrobialcellswithoutcultivation.Microbiol.Molec.Biol.Rev.,
59(1):143–169.Barrett,M.,Hiscock,K.,Pedley,S.,Lerner,D.,Tellam,J.,andFrench,M.(1999).Marker
speciesforidentifyingurbangroundwaterrechargesources:Areviewandcasestudyin
Nottingham,UK.WaterResearch,33(14):3083–3097.
Behrens,S.,Ruhland,C.,Inacio,J.,Huber,H.,Fonseca,A.,Spencer-Martins,I.,Fuchs,
B.,andAmann,R.(2003).Insituaccessibilityofsmall-subunitrRNAofmembersofthe
domainsBacteria,Archaea,andEucaryatoCy3-labeledoligonucleotideprobes.Appl.
69(3):1748–1758.,Microbiol.viron.EnBowman,J.andMcCuaig,R.(2003).Diversityandbiogeographyofprokaryotesdwelling
inAntarcticcontinentalshelfsediment.Appl.Environ.Microbiol.,69:2463–2484.
Chouari,R.,LePaslier,D.,Dauga,C.,Daegelen,P.,Weissenbach,J.,andSghir,A.(2005).
Novelmajorbacterialcandidatedivisionwithinamunicipalanaerobicsludgedigester.
DeLong,E.(1992).Archaeaincoastalmarineenvironments.Proc.Nat.Acad.Sci.,
89(12):5685–5689.Foss,S.andHarder,J.(1998).Thaueralinaloolentissp.nov.andThaueraterpenicasp.
nov.,isolatedonoxygen-containingmonoterpenes(linalool,menthol,andeucalyptol)and
nitrate.Syst.Appl.Microbiol.,21(3):365–373.
Foss,S.,Heyen,U.,andHarder,J.(1998).Alcaligenesdefragranssp.nov.,descriptionof
fourstrainsisolatedonalkenoicmonoterpenes((+)-menthene,α-pinene,2-carene,and
α-phellandrene)andnitrate.Syst.Appl.Microbiol.,21(2):237–44.
Harder,J.andFoss,S.(1999).Anaerobicformationofthearomatichydrocarbonp-cymene
frommonoterpenesbymethanogenicenrichmentcultures.Geomicrobiol.J.,16(4):295–
305.Hicks,R.,Amann,R.,andStahl,D.(1992).Dualstainingofnaturalbacterioplanktonwith
4’,6-diamidino-2-phenylindoleandfluorescentoligonucleotideprobestargetingkingdom-
level16SrRNAsequences.Appl.Environ.Microbiol.,58(7):2158–2163.
Holmes,D.,Nevin,K.,Woodard,T.,Peacock,A.,andLovley,D.(2007).Prolixibacterbellari-
ivoransgen.nov.,sp.nov.,asugar-fermenting,psychrotolerantanaerobeofthephylum
Bacteroidetes,isolatedfromamarine-sedimentfuelcell.Int.J.Syst.Evol.Microbiol.,
57(4):701.Hugenholtz,P.,Pitulle,C.,Hershberger,K.,andPace,N.(1998).Noveldivisionlevel
bacterialdiversityinaYellowstonehotspring.J.Bacteriol.,180(2):366–376.

109

1iptuscrMan10

Hyatt,D.,Youn,B.,Zhao,Y.,Santhamma,B.,Coates,R.,Croteau,R.,andKang,C.(2007).
Structureoflimonenesynthase,asimplemodelforterpenoidcyclasecatalysis.Proc.
104(13):5360.,Sci.Acad.Nat.Kane,M.D.,Poulsen,L.K.,andStahl,D.A.(1993).Monitoringtheenrichmentandisolation
ofsulfate-reducingbacteriabyusingoligonucleotidehybridizationprobesdesignedfrom
environmentallyderived16srrnasequences.Appl.Environ.Microbiol.,59(3):682–686.
Kreuzwieser,J.,Schnitzler,J.,andSteinbrecher,R.(1999).Biosynthesisoforganiccom-
poundsemittedbyplants.PlantBiol.,1(2):149–159.
Kubota,K.,Imachi,H.,Kawakami,S.,Nakamura,K.,Harada,H.,andOhashi,A.(2008).
EvaluationofenzymaticcelltreatmentsforapplicationofCARD-FISHtomethanogens.
J.Microbiol.Meth.,72(1):54–59.
Lin,L.,Hall,J.,Onstott,T.,Gihring,T.,Lollar,B.,Boice,E.,Pratt,L.,Lippmann-Pipke,
J.,andBellamy,R.(2006).Planktonicmicrobialcommunitiesassociatedwithfracture-
derivedgroundwaterinadeepgoldmineofSouthAfrica.Geomicrobiol.J.,23(6):475–
497.Lopez-Archilla,A.,Moreira,D.,Velasco,S.,andLopez-Garcia,P.(2007).Archaealand
BacterialcommunitycompositionofapristinecoastalaquiferinDonanaNationalPark,
Spain.Aquat.Microb.Ecol.,47(2):123.
Loy,A.,Lehner,A.,Lee,N.,Adamczyk,J.,Meier,H.,Ernst,J.,Schleifer,K.,andWagner,M.
(2002).Oligonucleotidemicroarrayfor16SrRNAgene-baseddetectionofallrecognized
lineagesofsulfate-reducingprokaryotesintheenvironment.Appl.Environ.Microbiol.,
68(10):5064–5081.Ludwig,W.,Strunk,O.,Westram,R.,Richter,L.,Meier,H.,Buchner,A.,Lai,T.,Steppi,
S.,Jobb,G.,Forster,W.,etal.(2004).ARB:asoftwareenvironmentforsequencedata.
Nucl.Ac.Res.,32(4):1363.
Madrid,V.,Taylor,G.,Scranton,M.,andChistoserdov,A.(2001).Phylogeneticdiversity
ofBacterialandArchaealcommunitiesintheanoxiczoneoftheCariacobasin.Appl.
67(4):1663–1674.,Microbiol.viron.EnManz,W.,Amann,R.,Ludwig,W.,Vancanneyt,M.,andSchleifer,K.(1996).Application
ofasuiteof16SrRNA-specificoligonucleotideprobesdesignedtoinvestigatebacteria
ofthephylumCytophaga-Flavobacter-Bacteroidesinthenaturalenvironment.Microbi-
142(5):1097–1106.,ologyMavrovouniotis,M.(1991).EstimationofstandardGibbsenergychangesofbiotransforma-
tions.J.Biol.Chem.,266(22):14440–14445.

110

Musat,F.andWiddel,F.(2008).Anaerobicdegradationofbenzenebyamarinesulfate-
reducingenrichmentculture,andcellhybridizationofthedominantphylotype.Environ.
10(1):10–19.,Microbiol.Neef,A.,Amann,R.,Schlesner,H.,andSchleifer,K.(1998).Monitoringawidespread
bacterialgroup:insitudetectionofplanctomyceteswith16SrRNA-targetedprobes.Mi-
144(12):3257–3266.,crobiologyNewman,J.andChappell,J.(1999).Isoprenoidbiosynthesisinplants:carbonpartitioning
withinthecytoplasmicpathway.Critic.Rev.Biochem.Molec.Biol.,34(2):95–106.
Patel,G.andSprott,G.(1990).Methanosaetaconciliigen.nov.,sp.nov.("Methanothrix
concilii")andMethanosaetathermoacetophilanom.rev.,comb.nov.Int.J.Syst.Evol.
40(1):79.,Microbiol.Pernthaler,A.,Pernthaler,J.,andAmann,R.(2002).Fluorescenceinsituhybridization
andcatalyzedreporterdepositionfortheidentificationofmarineBacteria.Appl.Environ.
68(6):3094–3101.,Microbiol.Pruesse,E.,Quast,C.,Knittel,K.,Fuchs,B.,Ludwig,W.,Peplies,J.,andGlockner,F.
(2007).SILVA:acomprehensiveonlineresourceforqualitycheckedandalignedriboso-
malRNAsequencedatacompatiblewithARB.Nucl.Ac.Res.,35(21):7188.
Raskin,L.,Stromley,J.,Rittmann,B.,andStahl,D.(1994).Group-specific16SrRNA
hybridizationprobestodescribenaturalcommunitiesofmethanogens.Appl.Environ.
60(4):1232–1240.,Microbiol.Rautio,M.,Eerola,E.,Väisänen-Tunkelrott,M.,Molitoris,D.,Lawson,P.,Collins,M.,and
Jousimies-Somer,H.(2003).ReclassificationofBacteroidesputredinisinanewgenus
Alistipesgen.nov.,asAlistipesputrediniscomb.nov.,anddescriptionofAlistipesfine-
goldiisp.nov.,fromhumansources.Syst.Appl.Microbiol.,26(2):182–188.
Schink,B.(1985a).Degradationofunsaturatedhydrocarbonsbymethanogenicenrichment
cultures.FEMSMicrobiol.Lett.,31(2):69–77.
Schink,B.(1985b).Fermentationofacetylenebyanobligateanaerobe,Pelobacter
acetylenicussp.nov.Arch.Microbiol.,142(3):295–301.
Schink,B.andStams,A.(2006).Syntrophyamongprokaryotes.InDworkin,M.,Falkow,
S.,Rosenberg,E.,Schleifer,K.H.,andStackebrandt,E.,editors,TheProkaryotes,vol-
ume2,chapter1.11,pages309–335.Springer-Verlag,New-York.
Scholten,J.andStams,A.(2000).Isolationandcharacterizationofacetate-utilizinganaer-
obesfromafreshwatersediment.Microb.Ecol.,40(4):292–299.

111

1iptuscrMan10Shigematsu,T.,Era,S.,Mizuno,Y.,Ninomiya,K.,Kamegawa,Y.,Morimura,S.,andKida,
K.(2006).Microbialcommunityofamesophilicpropionate-degradingmethanogeniccon-
sortiuminchemostatcultivationanalyzedbasedon16SrRNAandacetatekinasegenes.
72(2):401–415.,Biotechnol.Microbiol.Appl.Singer,A.,Crowley,D.,andThompson,I.(2003).Secondaryplantmetabolitesinphytore-
mediationandbiotransformation.TrendsBiotechnol.,21(3):123–130.
Song,Y.,Kononen,E.,Rautio,M.,Liu,C.,Bryk,A.,Eerola,E.,andFinegold,S.(2006).
Alistipesonderdonkiisp.nov.andAlistipesshahiisp.nov.,ofhumanorigin.Int.J.Syst.
56(8):1985.,Microbiol.ol.EvStahl,D.andAmann,R.(1991).Developmentandapplicationofnucleicacidprobesin
bacterialsystematics.Nucl.Ac.Tech.Bact.System.,pages205–248.
Stahl,D.,Flesher,B.,Mansfield,H.,andMontgomery,L.(1988).Useofphylogenetically
basedhybridizationprobesforstudiesofruminalmicrobialecology.Appl.Environ.Mi-
54(5):1079–1084.,crobiol.Tanaka,K.,Stackebrandt,E.,Tohyama,S.,andEguchi,T.(2000).Desulfovirgaadipica
gen.nov.,sp.nov.,anadipate-degrading,Gram-negative,sulfate-reducingbacterium.
Int.J.Syst.Evol.Microbiol.,50(2):639–644.
Tang,Y.,Shigematsu,T.,Morimura,S.,andKida,K.(2007).Effectofdilutionrateonthe
microbialstructureofamesophilicbutyrate-degradingmethanogeniccommunityduring
continuouscultivation.Appl.Microbiol.Biotechnol.,75(2):451–465.
Wallner,G.,Amann,R.,andBeisker,W.(1993).Optimizingfluorescentinsituhybridization
withrRNA-targetedoligonucleotideprobesforflowcytometricidentificationofmicroor-
ganisms.Cytometry,14(2).
Whitman,W.,Bowen,T.,andBoone,D.(2006).Themethanogenicbacteria.InDworkin,M.,
Falkow,S.,Rosenberg,E.,Schleifer,K.H.,andStackebrandt,E.,editors,TheProkary-
otes,volume3,chapter9,pages165–207.Springer-Verlag.
Zellner,G.,Messner,P.,Winter,J.,andStackebrandt,E.(1998).Methanoculleuspal-
moleisp.nov.,anirregularlycoccoidmethanogenfromananaerobicdigestertreating
wastewaterofapalmoilplantinnorth-Sumatra,Indonesia.Int.J.Syst.Evol.Microbiol.,
48(4):1111–1117.

112

11

Manuscript

2

113

11

uscrMan

114

ipt

2

oteobacteriaDeltapromfrisolated

hmentsenricdegradinglimonene

Amelia-ElenaRotaru§,ChristinaProbian§andJensHarder§

§DepartmentofMicrobiology,MaxPlanckInstituteforMarineMicrobiology,Celsiusstrasse1,D-28359,Bremen,

ymanGer

Manuscriptinpreparation

115

2iptuscrMan11

AbstractThemicroorganismsinvolvedinhydrocarbondegradationundermethanogenicconditions
arepredominantlyunknown.Here,wepursuedtoisolateandidentifymicroorganismspo-
tentiallyinvolvedinlimonenedegradationundermethanogenicconditions.Weisolated,
fromlimonenedegradingenrichments,microorganismsgrowingonlactateorfumarateun-
derfermentingconditions.TheseisolatesgroupedwithinDeltaproteobacteria,withonly
89%identitytotheirnextculturedrelative,Desulfoarculusbaarsii.Strainsisolatedonlac-
tatefermentedtheirsubstratetoacetate,propionateandbutyrate,whereasstrainsisolated
onfumarateaccumulatedacetateandsuccinate.Weproposethatthesenewstrainsrepre-
sentanewgenusenclosedinDeltaproteobacteriawhichcouldplaytheroleofsecondary
fermentersorsyntrophs,inlimonenedegradation.

oductionIntrMethanogenesisprevailsinanoxicenvironmentswhereelectronacceptorsotherthencar-
bondioxidearelimiting.Examplesofsuchenvironmentsareanoxicsediments,flooded
soils,sewagedigestorsandtheintestinaltractofanimalsandinsects(Whitmanetal.,
2006;Hattori,2008;Dolfingetal.,2008).Organicmatterisdegradedtomethaneandcar-
bondioxide,alowenergygainingprocessincomparisontootherrespiratoryprocesses.
Somemicroorganismshavetheabilitytocatabolizecomplexorganicmatteronlyiftheir
endmetabolitesareremovedbyametabolicallydifferentgroupofmicrobes(Schink,1997;
SchinkandStams,2006;McInerneyetal.,2008).Themutualisticrelationshipestablished
betweenmetabolicallydifferentorganismsisdefinedassyntrophy(SchinkandStams,
2006;McInerneyetal.,2008).
Numerousstudiesonsyntrophicco-culturesrevealedthecapacityofsuchcooperative
interactionstodegradefattyacids(BooneandBryant,1980;McInerneyetal.,1981;Stieb
andSchink,1985;Royetal.,1986;Wallrabensteinetal.,1994;Pluggeetal.,2002;Wu
etal.,2006;Dolfingetal.,2008),aminoacids(Zindeletal.,1988),alcohols(Bryantetal.,
1967;Ben-BassatandZeikus,1981;SchinkandStieb,1983;Schink,1985b)andaromatics
(SzewzykandSchink,1989;Jacksonetal.,1999;Qiuetal.,2003,2006,2008).Hydro-
carbondegradationundermethanogenicconditionswasdemonstratedbyearlierstudies
inenrichmentcultures(Schink,1985a;EdwardsandGrbic-Galic,1994;HarderandFoss,
1999;Meckenstock,1999;Zengleretal.,1999;AndersonandLovley,2000)orbyfieldmea-
surements(Reinhardetal.,2005).However,importantquestionsareleftunansweredsuch
as:“i)Whodegradeshydrocarbonsundermethanogenicconditions?”and“ii)Whatare
thepotentialintermediatesshuttledbetweenmicroorganismstoestablishaco-operative
action?”interThisstudytacklestheidentificationofmicroorganismsinvolvedinthedegradationofthe
mostwidespreadmonoterpene,limoneneundermethanogenicconditions.Limoneneis

116

producedbyplantsandisthemostwidespreadmonoterpeneinnature(Trudgill,1990).
Thedegradationofthismonoterpene,andthemicrobialcommunitycompositionswaspre-
viouslystudied(Rotaruetal.,Prep).Herewepursueisolationofsyntrophicmicroorgan-
ismsfromlimonenedegradingenrichmentcultures.Thestrainswereisolatedontwofer-
mentablesubstrates,fumarateandlactate.Wedeterminedthephylogenyofthesestrains,
andtheabilitytogrowinthepresenceoflimonene,inco-culturewithamethanogen,
.eimazMethanosarcina

methodsandMaterials

Cultivationofmicroorganisms

Enrichment.Sedimentfreemethanogenicculturesgrowingondifferentmonoterpenes
wereestablishedearlierfromwastewatertreatmentplantonothermonoterpenes(Harder
andFoss,1999)andlatergrownwith5%limonenein2,2,4,6,8,8-hepta-methylnonane
(HMN)(Rotaruetal.,Prep).MethanogenicfreshwatermediawaspreparedafterHarder
(1999).ossFand

Isolationofmicroorganismsfromlimonenedegradingenrichments.Potentialsyn-
trophicmicroorganismswereisolatedanaerobicallywiththerolltubetechnique(Hungate,
1969)usingfermentablesubstrates,likefumarate(50mM)orlactate(50mM),asenergy
source.Atotalof40colonieswereselected.Eachcolonywasresuspendedandinoculated
infreshwaterliquidmedia.Theseresuspendedcolonieswereinoculatedin3tubestoen-
surethechanceofsurvivalduringtransfer.Theculturesweretransferredandmaintained
underfermentingconditionsin15mlHungatetubeswith10mlfreshwatermedia,lactate
(50mM)orfumarate(50mM).Purityofcultureswasroutinelyverifiedbyphasecontrast
.ymicroscop

Co-cultivationofisolatedstrainswithMethanosarcinamazei.Thenewlyisolated
strainswereincubatedinco-culturewithM.mazei.Themethanogenwaskindlysupplied
byJanaMilucka.Forthisexperimenttheenergysourcewas5%limoneneinHMN(vol/vol)
overlaidontopoffreshwatermineralmedia.Thefreshwatermediawaspreparedasmen-
tionedabove.Theinoculawas10%isolate(vol/vol)and10%(vol/vol)M.mazei.Each
oftheisolatedcultureswereincubatedwith5%limonene(inHMN)intheabsenceofM.
mazei.AnothercontrolwasM.mazeiincubatedwithacetate(10mM)inthepresence
ofthemonoterpene.Theopticaldensityincreasewasmonitoredbydirectmeasuringof
culturingtubesonaShimadzuUV-VISSpectrophotometer.

117

2iptuscrMan11

ysisanalChemicalAllsamplesforchemicalanalysiswereretrievedwithN2flushedhypodermicneedlesand
.ingessyrFattyacidsweredetectedbyhighperformanceliquidchromatographyonaSykamHPLC
(Sykam).FilteredsampleswereinjectedusingaSykamS5200autosampler.Separation
wasperformedonanAminexHPX-87Hcolumn(300x7.8mm)underisothermalconditions
(40°C).Theeluentwas5mMH2SO4.FattyacidsweredetectedwithaLINEARUVIS
Detector.DataacquisitionandprocessingwasdonewithDataApexClarityHPLCSoftware
(GammaAnalysenTechnikGmbH).Ourstandardsconsistedofthefollowingfattyacids:
succinate,lactate,formate,acetate,propionateandbutyrate.Thedetectionlimitwas0.1
mM.Fumarateandformateexhibitthesameretentiontimeonthecolumn.

Molecularanalysisofisolatedstrains
Denaturinggradientgelelectrophoresis(DGGE).AstemplateforDGGEPCR-ampli-
ficationweusedlyzedcellsofisolatedstrainsandtotalDNAextractedfromalimonene
degradingenrichment.TheDNAextractionwasdoneaspublishedelsewhere(Zhouetal.,
1996).TheamplificationreactionmixforDGGEconsistedof:2μMeachprimer(GM5-GC
and907-RM),0.2mMtotaldNTPs,0.04UTaq-Polymerase,30μgbovineserumalbumin,
1×PCREnhancerand1×PCRbufferinafinalvolumeof100μl.TheDGGEamplification
wascarriedonanEppendorfMastercycler(Eppendorf)withaninitialdenaturingstepof5
minat95°C,followedbypolymeraseadditionat80°C,primerannealingat65°Cfor1min,
and3minelongationat72°C.Thenext23cyclescomprisedonedenaturingstepof1min
at94°C,primerannealing-65°Cfor1min,and3minelongationat75°C.Forthefollowing
19cyclestherewasadecreaseoftheannealingtemperatureaswellaselongationtem-
perature,downto65°Cand72°C,respectively.Thefinalelongationstepwas10minat
72°C.Thedenaturinggradientgelwaspreparedaspublishedelsewhere(Muyzeretal.,
1996)andrunfor3.5hoursat200mV.Bandswithhighintensitywerechosenforsequenc-
ing.Thesequencingreactionsweredoneasmentionedbelow.Sequencesofcirca500
bpwereaddedbymaximumparsimonytothephylogenetictreecalculatedasexplained
.wbelo

Sequencinganalysis.Freeze-thawlyzedcellswereusedastemplatefortheamplifi-
cationofthe16SrRNAgenewithbacterialprimers,GM3andGM4(Hicksetal.,1992;
Kaneetal.,1993).Thereactionmixconsistedof1μMofeachprimer,1mMtotaldNTPs,
0.04UTaq-Polymerase,15μgbovineserumalbuminand1×PCRbufferin50μl.PCR
amplificationwascarriedonanEppendorfMastercycler(Eppendorf)withaninitialdena-
turingstepof5minat96°C,followedby30cyclesthatinvolveddenaturingfor1minat
96°C,primerannealingat48°Cfor1min,and3minelongationat72°C.Thesecycles
werefollowedbyafinalelongationstepof10minat72°C.Theampliconswerepurified
bygravitycentrifugingat910RCFonSephadexSuperfineG50columns(AmershamBio-

118

sciences).Purifiedampliconswereusedastemplateforsequencingreactionsgenerated
accordingtothemanufacturer’smanualandanalyzedona3130XLGeneticAnalyser(Ap-
pliedBiosystems).Sequenceswerecleanedofvectordataandassembledintocontigs
usingDNA-Baser(www.dnabaser.com).Thenearlycomplete16SrRNAgenesequence
data2004).wAeremaximalignedumwiththeparsimonyARB-Silvphaylogeneticsoftwaretreepacwaskage(Prcalculateduesseeetal.,xcluding2007;theLudwiginfluenceetal.,of
highlyvariablepositions.Thetreewasreconstructedonlyusingsequenceswithmorethen
.bp1200

discussionsandResultsIsolationofnovelDeltaproteobacteriafromlimonenedegradingenrichments
Fromlimonenedegradingmethanogenicenrichments,weisolatedsevenstrainsinferment-
ingconditions,withfumarateorlactateasenergysources.Theuseofsuchsubstratesthat
aremoreoxidizedthentheinitialoneisawelldescribedprocedureforisolationofsyn-
trophicmicroorganisms(Schink,1985a;BeatyandMcInerney,1987;Wallrabensteinetal.,
1995a).1994,Numerousyellow-whitecolonieswereobtainedusingtherolltubetechnique(Hungate,
1969).Weselected40ofthem,fortransferinfreshwatermethanogenicliquidmedia.Trans-
ferstookmorethen6monthsforgrowthandonly8coloniesdevelopedintostableliquid
cultures.Fromthese,threefermentedlactate(SynL-5-9-c1,SynL-5-9-c2andSynL-65)
andtheotherfivefermentedfumarate(SynF-5-17-c1,SynF-5-17-c2,SynF-5-17-c3,SynF-
5-18-c1).Lactateisolatedstrainswererepresentedbylargevibrioshapedcellswithan
averagesizeof0.9μm×2.5μm.Thefumarateisolatedstrainswerelesscurvedand
slightlysmallerwithanaveragesizeof0.8μm×2.4μm(Figure11.1).

ofileprFermentationWeanalyzedthefattyacidprofileforlactateandfumarateutilizingstrains.
Theisolateswhichgrewonlactateproducedacetate,propionateandbutyrate.Inaver-
age,foreach1mMlactateconsumed,theproductswere1mMacetateandlessthen0.05
mMpropionateandbutyrate(Table11.2).Lactatefermentationtoacetateinaratioof1to
1wasalsoobservedinthethermophilicsyntrophic,propionateoxidizerDesulfotomaculum
thermobenzoicumsubsp.thermosyntrophicum(Pluggeetal.,2002).D.thermobenzoicum
cangrowbyfermentationbesideslactate,alsowithbenzoate,fumarate,hydrogen,and
pyruvate.
Theisolateswhichgrewonfumarateproducedacetateandsuccinate.Foreach1mM
fumarateconsumedweidentifiedtheevolutionof1.5to2mMacetate,andlessthen0.4
mMsuccinate(Table11.2).
Syntrophobacterstrainsarecapableofgrowthundersulfatereducingconditions,with

119

2iptuscrMan11differentsubstrates.Afullmetabolicprofileofthesestrainscouldrevealmoreondifferent
aspectsoftheirphysiology.Questionsthatremaintobeaddressedare:„Iftheyuseother
electronacceptors?“„Consideringthefullidentitybetweenlactateandfumarate-utilizing
strains,aretheyassimilaratthephysiologicallevel?“„Whatothersubstratescantheyfer-
ment?“„Whatsubstratescouldtheyspecificallyfermentinco-culturewithamethanogen?“

Co-cultureswithMethanosarcinamazei
Thegrowthoflactateandfumarateisolatedsyntrophsinco-culturewithM.mazeiinthe
presenceof5%limonene(vol/volinHMN)wasmonitoredfor71days.Strainsgrewat
higheropticaldensitythenwhencultivatedaloneinthepresenceoflimonene(Figure11.4).
Regardlessofthehighercelldensitiesthatwerefoundinco-culturesthrivingonlimonene,
thefattyacidprofilessuggestthatlimonenedegradationwasnotontheaccountofthe
newisolates(Table11.2).Thedifferenceinthefattyacidprofilesforlactate-andfumarate-
isolatedstrainsaloneorinco-cultureswasmostlikelyduetotheutilizationofendoge-
nouscarbonsources(lactate,fumarateoracetate),carriedwiththeinoculaandnotdueto
utilization.limonene

ysisanaleneticylogPhThephylogeneticpositionwasdeterminedby16SrRNAsequenceanalysis(Figure11.3).
WeobtainedsequencesofeachisolateandcomparedthemusingtheARBsoftware.The
resultingisolateswererepresentativesofasinglephylotypewithlessthen1%difference
betweeneachother.Theirclosestunculturedrelative(91.2%)wasasequenceretrieved
from4-methyl-benzoatedegradingmethanogenicenrichment(Wuetal.,2001).Whereas
theclosestculturedrelative(11%difference),wasasulfatereducerthatutilizesformate,
andcannotutilizelactate,Desulfoarculusbaarsii(Widdel,1980,1981).Moreovertheiso-
lateswerefarrelatedtogenusSyntrophobacter.Eventhenearestneighborwithinthis
genus,Syntrophobacterphennigii(Wallrabensteinetal.,1995b),showedonly85%16S
rRNAgeneidentitytothesestrains.Wesuggestthatthesenovelisolatesestablishanovel
branchwithinDeltaproteobacteria,sincetheyarefarfromtheirnextinculturerelative,D.
baarsii,bothatthephylogeneticandphysiologiclevel.
AnothertoolfordeterminingtherelationshipbetweenisolateswasDGGEpatternanal-
ysis.Weobservedasimilarpositionfortheiramplified16SrDNAgeneindenaturinggel
(Figure11.2).Howevertwoofthefumarateisolatesshowedasecondbandatahigher
positiononthegel.Thiscouldbedueto:i)impurityofcultures,sodifferentDGGEpatterns
emerged;ii)eachstrainshastwodifferent16SrRNAoperons.Thiscouldresultfroman
insertionorahigherG+Ccontentinoneofthe16Soperons.ThedominantDGGEband
thatwascommonforalltheisolatedstrains,wassequencedandwas100%identicalto
the16SrRNAgenesequencesoftheisolates(Figure11.2).Thephylotypewaspresentin
limonenedegradingenrichmentcultures,sinceasimilarDGGEbandwasobserved.

120

WesuggestthatthesenewlyisolatedDeltaproteobacteriadonotplaytheroleofpri-
maryfermentersinlimonenedegradation,butofsecondaryfermenters(syntrophs),likely
beinginvolvedinshortchainfattyacidoralcoholdegradation.Abetterunderstandingof
thephysiologyofthesestrains,couldoffermoreinsightsonthemechanismoflimonene
methanogenicdegradation.Isolationofprimaryfermenterscapableoflimonenedegrada-
tioncouldbepursuedbyincubationwithlargerfattyacidsandalcoholsassubstratesfor
fermentation.Anotherquestionwhichcouldbeaddressedis„Ifthreeistheminimumnum-
berofmembersnecessaryforlimonenedegradationundermethanogenicconditions,or
isthereaneedformore?“Successfulisolationofprimaryfermenterscouldbethestart
pointfortri-cultureexperimentsinthepresenceofDeltaproteobacteria-relatedisolatesand
differenttypesofmethanogensthrivingsolelyonlimonene.
HereweisolatedlactateandfumaratefermentingDeltaproteobacteriaandweobserved
thattheycangrowinthepresenceoflimoneneinco-culturewithanacetotrophicand/orhy-
drogenotrophicmethanogen.Conclusivedataontheirinvolvementinlimonenedegradation
remaintobebroughtinafurtherstudy.

wledgmentsknoAc

WewouldliketothankJanaMiluckaforsupplyinggrowingculturesofMethanosarcina
mazei,andReginaSchauerforintroductiontoDGGE.Wethankforfinancialsupportthe
MaxPlanckSocietyandforpartialfundingtheInternationalResearchSchoolforMarine
.Microbiology

121

2iptuscrMan11

andFigureslestab

122

Figure11.1:Phasecontrastmicrographsofculturesisolatedfrom
limonenedegradingmethanogenicenrichments.Aculture
isolatedonlactateisshowninpanelAandoneisolatedon
fumarateisshowninpanelB.Thescalebaris5μm.

Figure11.2:DGGEpatternsofnewlyisolatedstrainsandextracted16SrDNAofanenrichment
.limoneneonivingthr

Figure11.3:Maximumparsimonyphylogenetictreeof16SrRNAgenesequencesofmicroor-
ganismsisolatedfromlimonenedegradingmethanogenicenrichmentcultures(blue).
Theclosestrelatedclonesfromlimonenedegradingenrichmentsareemphasizedin
green.ThetreewasrootedusingChlorobisequencesasanout-group.Thescalebar
represents10substitutionsper100bp.

Figure11.4:Growthofco-cultureswith5%limoneneinHMN(vol/vol)asenergysource(squares)
versusisolatesalone(downtriangles)orM.mazeialone(uptriangles)withlimonene
asenergysource.PanelAshownthecorrespondingdataforalactateisolatedor-
ganismSynL-5-9-c2,whilepanelBshowsthedataforafumarateisolatedorganism
SynF-5-17-c1.

123

112iptuscrMan

124

Table11.1:16SrRNAprimersusedfordenaturinggradientgelelectrophoresis

PRIMERSEQUENCE(5’-3’)POSITIONREFERENCE
GM5F-GCaCCTACGGGAGGCAGCAG341-357(Muyzeretal.,1993)
907RCCGTCAATTCCTTTGAGTTT907-927(Muyzeretal.,1995)
F(forward)andR(reverse)indicatetheorientationoftheprimersinrelationtotherRNAsequence
aCGGGGGG-3´5´-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCAclamp:GC

Table11.2:FattyacidprofileofnewlyisolatedDeltaproteobacteria,grownonlactateandfumarate,intheab-
senceorpresenceoflimonene,andinco-culturewithMethanosarcinamazei.
Substrateadded:SubstratefinalFattyacidsproduced(mM)
(mM)Strain(mM)*Limonene(mM)*Lactate(mM)*ateFumarLactateateFumarAcetate**SuccinatePropionateateButyr
SynL-5-9-c1-50-31.6-24.6-0.80.8
SynL-5-9-c2-50-36.2-18.2-0.80.6
SynL-65-50-31.6-18.6-1.30.6
SynF-5-17-c1--50-23.931.12.1--
SynF-5-17-c2--50-36.030.42.40.4-
SynF-5-17-c3--50-29.738.88.8--
SynF-5-18-c1--50-28.639.80.2--
SynL-5-9-c1275-1.2-6.7-0.1-
SynL-5-9-c2275-0.4-7.2-0.1-
SynL-65275-0.6-6.8-0.1-
SynF-5-17-c127-5-13.80.2---
SynF-5-17-c227-5-18.8-0.7--
SynF-5-17-c327-5-11.80.2---
SynF-5-18-c127-5-9.00.50.2--
SynL-5-9-c1+M.mazei275-0.8-----
SynL-5-9-c2+M.mazei275-2.4-2.3-3.7-
SynL-65+M.mazei275-1.5-----
SynF-5-17-c1+M.mazei27-5-3.000.3--
SynF-5-17-c2+M.mazei27-5-3.100.5--
SynF-5-17-c3+M.mazei27-5-2.70.30.6--
SynF-5-18-c1+M.mazei27-5-4.000.2--
*Thesesubstrateswereaddedintheseamountstothefreshwatermedia,howeverthesearenotmeasureddata.
**Theamountofacetateiscalculatedbysubtractingtheamountofacetateknowntobeaddedtothemedia(
detectedas2mMincontrolcultureswithoutinocula)fromthemeasuredacetateinculturesmediaattheendofthe
incubation.

erencesRefAnderson,R.andLovley,D.(2000).Biogeochemistry:hexadecanedecaybymethanogen-
404(6779):722–723.,Nature.esisBeaty,P.andMcInerney,M.(1987).GrowthofSyntrophomonaswolfeiinpurecultureon
147(4):389–393.,Microbiol.Arch.crotonate.Ben-Bassat,A.andZeikus,J.(1981).Thermobacteroidesacetoethylicusgen.nov.and
spec.nov.,anewchemoorganotrophic,anaerobic,thermophilicbacterium.Arch.Micro-
128(4):365–370.,biol.Boone,D.andBryant,M.(1980).Propionate-degradingbacterium,Syntrophobacterwolinii
sp.nov.gen.nov.,frommethanogenicecosystems.Appl.Environ.Microbiol.,40(3):626–
632.Bryant,M.,Wolin,E.,Wolin,M.,andWolfe,R.(1967).Methanobacillusomelianskii,a
symbioticassociationoftwospeciesofbacteria.Arch.Microbiol.,59(1):20–31.
Dolfing,J.,Larter,S.,andHead,I.(2008).Thermodynamicconstraintsonmethanogenic
crudeoilbiodegradation.ISMEJ.,16(2):442–452.
Edwards,E.andGrbic-Galic,D.(1994).Anaerobicdegradationoftolueneando-xyleneby
amethanogenicconsortium.Appl.Environ.Microbiol.,60(1):313–322.
Ficker,M.,Krastel,K.,Orlicky,S.,andEdwards,E.(1999).Molecularcharacterizationof
atoluene-degradingmethanogenicconsortium.Appl.Environ.Microbiol.,65(12):5576–
5585.Harder,J.andFoss,S.(1999).Anaerobicformationofthearomatichydrocarbonp-cymene
frommonoterpenesbymethanogenicenrichmentcultures.Geomicrobiol.J.,16(4):295–
305.Hattori,S.(2008).Syntrophicacetate-oxidizingmicrobesinmethanogenicenvironments.
Microb.Environ.,23(2):118–127.
Hicks,R.,Amann,R.,andStahl,D.(1992).Dualstainingofnaturalbacterioplanktonwith
4’,6-diamidino-2-phenylindoleandfluorescentoligonucleotideprobestargetingkingdom-
level16SrRNAsequences.Appl.Environ.Microbiol.,58(7):2158–2163.
Hungate,R.(1969).Arolltubemethodforcultivationofstrictanaerobes.Meth.Microbiol.,
3:117–132.Jackson,B.,Bhupathiraju,V.,Tanner,R.,Woese,C.,andMcInerney,M.(1999).Syntro-
phusaciditrophicussp.nov.,anewanaerobicbacteriumthatdegradesfattyacidsand
benzoateinsyntrophicassociationwithhydrogen-usingmicroorganisms.Arch.Micro-
171(2):107–114.,biol.

125

2iptuscrMan11Kane,M.D.,Poulsen,L.K.,andStahl,D.A.(1993).Monitoringtheenrichmentandisolation
ofsulfate-reducingbacteriabyusingoligonucleotidehybridizationprobesdesignedfrom
environmentallyderived16srrnasequences.Appl.Environ.Microbiol.,59(3):682–686.
Ludwig,W.,Strunk,O.,Westram,R.,Richter,L.,Meier,H.,Buchner,A.,Lai,T.,Steppi,
S.,Jobb,G.,Forster,W.,etal.(2004).ARB:asoftwareenvironmentforsequencedata.
Nucl.Ac.Res.,32(4):1363.
McInerney,M.,Bryant,M.,Hespell,R.,andCosterton,J.(1981).Syntrophomonaswolfei
gen.nov.sp.nov.,ananaerobic,syntrophic,fattyacid-oxidizingbacterium.Appl.Environ.
41(4):1029–1039.,Microbiol.McInerney,M.,Struchtemeyer,C.,Sieber,J.,Mouttaki,H.,Stams,A.,Schink,B.,Rohlin,
L.,andGunsalus,R.(2008).Physiology,ecology,phylogeny,andgenomicsofmicroor-
ganismscapableofsyntrophicmetabolism.Ann.NYAcad.Sci.,1125(1):58–72.
Meckenstock,R.(1999).Fermentativetoluenedegradationinanaerobicdefinedsyntrophic
cocultures.FEMSMicrobiol.Lett.,177(1):67–73.
Musat,F.andWiddel,F.(2008).Anaerobicdegradationofbenzenebyamarinesulfate-
reducingenrichmentculture,andcellhybridizationofthedominantphylotype.Environ.
10(1):10–19.,Microbiol.Muyzer,G.,DeWaal,E.,andUitterlinden,A.(1993).Profilingofcomplexmicrobialpopu-
lationsbydenaturinggradientgelelectrophoresisanalysisofpolymerasechainreaction-
amplifiedgenescodingfor16SrRNA.Appl.Environ.Microbiol.,59(3):695–700.
Muyzer,G.,HottentrÃCger,S.,Teske,A.,andWaver,C.,editors(1996).Denaturinggra-
dientgelelectrophoresisofPCR-amplified16SrDNA-Anewmolecularapproachto
analysethegeneticdiversityofmixedmicrobialcommunities.Molecularmicrobialecol-
ogymanual.KluwerAcademicPublishers,Dordrecht,Netherlands,2ndedition.
Muyzer,G.,Teske,A.,Wirsen,C.,andJannasch,H.(1995).Phylogeneticrelationshipsof
Thiomicrospiraspeciesandtheiridentificationindeep-seahydrothermalventsamples
bydenaturinggradientgelelectrophoresisof16SrDNAfragments.Arch.Microbiol.,
164(3):165–172.Plugge,C.,Balk,M.,andStams,A.(2002).Desulfotomaculumthermobenzoicumsubsp.
thermosyntrophicumsubsp.nov.,athermophilic,syntrophic,propionate-oxidizing,spore-
formingbacterium.Int.J.Syst.Evol.Microbiol.,52(2):391–399.
Pruesse,E.,Quast,C.,Knittel,K.,Fuchs,B.,Ludwig,W.,Peplies,J.,andGlockner,F.
(2007).SILVA:acomprehensiveonlineresourceforqualitycheckedandalignedriboso-
malRNAsequencedatacompatiblewithARB.Nucl.Ac.Res.,35(21):7188.
Qiu,Y.,Hanada,S.,Ohashi,A.,Harada,H.,Kamagata,Y.,andSekiguchi,Y.(2008).Syn-
trophorhabdusaromaticivoransgen.nov.,sp.nov.,thefirstculturedanaerobecapableof

126

degradingphenoltoacetateinobligatesyntrophicassociationswithahydrogenotrophic
methanogen?Appl.Environ.Microbiol.,74(7):2051–2058.
Qiu,Y.,Sekiguchi,Y.,Hanada,S.,Imachi,H.,Tseng,I.,Cheng,S.,Ohashi,A.,Harada,H.,
andKamagata,Y.(2006).Pelotomaculumterephthalicumsp.nov.andPelotomaculum
isophthalicumsp.nov.:twoanaerobicbacteriathatdegradephthalateisomersinsyn-
trophicassociationwithhydrogenotrophicmethanogens.Arch.Microbiol.,185(3):172–
182.Qiu,Y.,Sekiguchi,Y.,Imachi,H.,Kamagata,Y.,Tseng,I.,Cheng,S.,Ohashi,A.,
andHarada,H.(2003).Sporotomaculumsyntrophicumsp.nov.,anovelanaerobic,
syntrophicbenzoate-degradingbacteriumisolatedfrommethanogenicsludgetreating
wastewaterfromterephthalatemanufacturing.Arch.Microbiol.,179(4):242–249.
Reinhard,M.,Hopkins,G.,Steinle-Darling,E.,andLeBron,C.(2005).Insitubiotrans-
formationofBTEXcompoundsundermethanogenicconditions.GroundWaterMonit.
25(4):50–59.,Remed.Rotaru,A.,Schauer,R.,Probian,C.,Mussmann,M.,andHarder,J.(InPrep.).Candidate
DivisionOP3cellsinmethanogenicenrichmentculturesdegradinglimonene.Manuscript
ation.preparinRoy,F.,Samain,E.,Dubourguier,H.,andAlbagnac,G.(1986).Synthrophomonassapovo-
ranssp.nov.,anewobligatelyprotonreducinganaerobeoxidizingsaturatedandunsat-
uratedlongchainfattyacids.Arch.Microbiol.,145(2):142–147.
Schink,B.(1985a).Degradationofunsaturatedhydrocarbonsbymethanogenicenrichment
cultures.FEMSMicrobiol.Lett.,31(2):69–77.
Schink,B.(1985b).Fermentationofacetylenebyanobligateanaerobe,Pelobacter
acetylenicussp.nov.Arch.Microbiol.,142(3):295–301.
Schink,B.(1997).Energeticsofsyntrophiccooperationinmethanogenicdegradation.Mi-
crobiol.Molec.Biol.Rev.,61(2):262–280.
Schink,B.andStieb,M.(1983).Fermentativedegradationofpolyethyleneglycolbya
strictlyanaerobic,gram-negative,nonsporeformingbacterium,Pelobactervenetianussp.
nov.Appl.Environ.Microbiol.,45(6):1905–1913.
Stieb,M.andSchink,B.(1985).AnaerobicoxidationoffattyacidsbyClostridiumbryantii
sp.nov.,asporeforming,obligatelysyntrophicbacterium.Arch.Microbiol.,140(4):387–
390.Szewzyk,U.andSchink,B.(1989).Degradationofhydroquinone,gentisate,andbenzoate
byafermentingbacteriuminpureordefinedmixedculture.Arch.Microbiol.,151(6):541–
545.

127

2iptuscrMan11Trudgill,P.(1990).Microbialmetabolismofmonoterpenes-recentdevelopments.Biodegra-
1(2):93–105.,dationWallrabenstein,C.,Gorny,N.,Springer,N.,Ludwig,W.,andSchink,B.(1995a).Pure
cultureofSyntrophusbuswellii,definitionofitsphylogeneticstatus,anddescriptionof
Syntrophusgentianaesp.nov.Syst.Appl.Microbiol.,18(1):62–66.
Wallrabenstein,C.,Hauschild,E.,andSchink,B.(1994).Purecultureandcytological
propertiesof’Syntriphobacterwolini’.FEMSMicrobiol.Lett.,123(3):249–254.
Wallrabenstein,C.,Hauschild,E.,andSchink,B.(1995b).Syntrophobacterpfennigiisp.
nov.,newsyntrophicallypropionate-oxidizinganaerobegrowinginpureculturewithpro-
pionateandsulfate.Arch.Microbiol.,164(5):346–352.
Whitman,W.,Bowen,T.,andBoone,D.(2006).Themethanogenicbacteria.InDworkin,M.,
Falkow,S.,Rosenberg,E.,Schleifer,K.H.,andStackebrandt,E.,editors,TheProkary-
otes,volume3,chapter9,pages165–207.Springer-Verlag.
Widdel,F.(1980).Anaeroberabbauvonfettsaurenundbenzoesauredurchneuisolierte
artensulfat-reduzier-enderbakterien.PhDthesis,Georg-August-UniversitatGottingen,
Gottingen.,urg-LippeLindhorst/SchaumbWiddel,F.(1981).Validationofthepublicationofnewnamesandnewcombinationsprevi-
ouslyeffectivelypublishedoutsidetheIJSB:ListNo.7.Int.J.Syst.Bacteriol.,31(3):382–
383.Wu,C.,Liu,X.,andDong,X.(2006).Syntrophomonaserectasubsp.sporosyntropha
subsp.nov.,aspore-formingbacteriumthatdegradesshortchainfattyacidsinco-culture
withmethanogens.Syst.Appl.Microbiol.,29(6):457–462.
Wu,J.,Liu,W.,Tseng,I.,andCheng,S.(2001).Characterizationofa4-methylbenzoate-
degradingmethanogenicconsortiumasdeterminedbysmall-subunitrDNAsequence
analysis.J.Biosc.Bioeng.,91(5):449–455.
Zengler,K.,Richnow,H.,Rossell,R.,Michaelis,W.,andWiddel,F.(1999).Methanefor-
mationfromlong-chainalkanesbyanaerobicmicroorganisms.Nature,401(6750):266.
Zhou,J.,Brunns,M.A.,andTiedje,J.M.(1996).Dnarecoveryfromsoilsofdiverse
composition.Appl.Environ.Microbiol.,62:316–322.
Zindel,U.,Freudenberg,W.,Rieth,M.,Andreesen,J.,Schnell,J.,andWiddel,F.(1988).
Eubacteriumacidaminophilumsp.nov.,aversatileaminoacid-degradinganaerobepro-
ducingorutilizinghydrogenorformate.Arch.Microbiol.,150(3):254–266.

128

12

uscriptMan

3

129

12

uscrMan

130

ipt

3

Highlhedenricy

oteobacteriaBetaprgrowinganaerobicallywithp-xyleneand

nitrate

Amelia-ElenaRotaru§,ChristinaProbian§,HeinzWilkes†andJensHarder§

§DepartmentofMicrobiology,MaxPlanckInstituteforMarineMicrobiology,Celsiusstrasse1,D-28359,Bremen,
ymanGer

†Helmholtz-ZentrumPotsdam,DeutschesGeoForschungZentrum,Sektion4.3OrganischeGeochemie,
Telegrafenberg,D-14473,Potsdam,Germany

IntendedforFEMSMicrobialEcology

131

iptuscrMan123

AbstractTheidentityofthemicroorganismsresponsibleforanaerobicp-xylenedegradationandthe
mechanismofactivationunderdenitrifyingconditionsarehithertounknown.Herewereport
highlyenrichedculturesoffreshwaterdenitrifyingmicroorganismsthatgrowanaerobically
withp-xyleneassoleelectrondonor.A16SrRNAgene-basedapproachwasusedtoiden-
tifythedominantmicroorganismsinthesecultures,whicharelongcurvedrodswith95%
16SrRNAgenesequenceidentitytoDenitratisomaoestradiolicum.Thisphylotypebelongs
totheRhodocyclaceaefamily,ratherdistanttootherdenitrifyinghydrocarbondegraders
whichclusterwithinAzoarcus-Thauera.Accordingtoquantitativegrowthexperimentsand
chemicalanalysis,p-xylenewascompletelyoxidizedtoCO2,via(4-methylbenzyl)succi-
nateand(4-methylphenyl)itaconateasintermediarymetabolites.

oductionIntrThearomatichydrocarbonp-xylene(1,4-dimethylbenzene),isacomponentofpetroleum
(TissotandWelte,1984)andrawmaterialforthechemicalindustry.p-Xyleneproduction
reaches2.2×103tonesperyear(AssociationofpetrochemicalsproducersinEurope,
A.P.P.E.),sinceitisusedtomanufacturesolventsandprecursors,suchasterephthalic
acid,theprecursorofpolyester.
Thedischargeofp-xyleneintofreshwaterfrompetroleumseepsisthoughttobesur-
passedbyanthropogenicrelease,suchasaccidentalspillsoffuelandleakagefromtankers
.pipeshaulingandp-Xyleneisanon-polarcompoundwitharelativelyhighwatersolubility(0.18g/Lat
25°C)(ShiuandMa,2000).Suchpropertiesplacep-xyleneamongthemostmobileand
toxicpetroleum-derivedgroundwatercontaminants,alongwithbenzene,toluene,ethylben-
zene,ando-andm-xylene(AndersonandLovley,1997).Thefateofp-xyleneintheenvi-
ronmentisdeterminedbychemicalandmicrobialprocesses(Tuazonetal.,1984;Atkinson
etal.,1991;Headetal.,2006).Aerobicmicroorganismsactivatep-xyleneto3,6-dimethyl-
catechol,aprocesscatalyzedbydioxygenases(Wackett,2006).Whereasunderanaerobic
conditions,whichoftenprevailinundergroundwatersandaquifers,p-xyleneisremovedby
microorganismsthrivingundernitrate-,sulfate-,iron(III)-reducingormethanogeniccondi-
.tionsp-XyleneisoftheleastdegradableconsitutentsoftheentireBTEXfraction,alongwith
benzeneando-xylene(Heideretal.,1999;Widdeletal.,2006;Foght,2008).Incontrast
top-xylene,benzeneando-xylenesupportedanaerobicgrowthofpurecultures(Harms
etal.,1999;Coatesetal.,2001;Moraschetal.,2004;Kasaietal.,2006),whereasonly
threestudiesobtainedstableenrichmentculturesandconfirmedanaerobicdegradationof
p-xyleneunderdenitrifyingandsulfatereducingconditions(Haneretal.,1995;Morasch
andMeckenstock,2005;Nakagawaetal.,2008).16SrRNAgenefragmentsfromdenatur-

132

inggelsshowedthepresenceofauniquesequencetype(Nakagawaetal.,2008)relatedto
DesulfosarcinaovatastrainoXyS1ano-xylenedegradingsulfate-reducingbacteria(Harms
etal.,1999).Moreoverp-xylenelosswasalsodetectedunderiron-reducingconditions
(BottonandParsons,2007)andthe16SrRNAgenefragmentsretrievedfromtheseenrich-
mentswererelatedtoGeobacterandDeltaproteobacteria(Bottonetal.,2007).Theiden-
tityofdenitrifyingmicroorganismsinvolvedinp-xylenedegradationwasneveraddressed.
Thereforeinthisstudyweidentifiedandquantifiedthemembersofahighlyenrichedcom-
munitythatdegradesp-xyleneundernitratereducingconditions.Thedominantphylotype
ofthemicrobialcommunitywasdetectedusinga16SrRNAgene-basedapproach(Amann
1995).al.,etBenzylsuccinicacidanditsmethylatedanalogueshavebeenproposedasindicatorsof
anaerobictolueneandxylenemetabolismincontaminatedenvironments(Beller,2000;
Elshahedetal.,2001;Suflita,2002).Toconfirmthatp-xyleneisactivatedindenitrifiers
similarlytosulfatereducers,byadditiontofumarate(MoraschandMeckenstock,2005),we
performedgaschromatography-massspectrometricanalysisofmetabolites.

MethodsandMaterials

Sourceoforganismsandcultivation
Amixedinoculaof150mlfreshwaterpondsedimentand50mlsludgefromawastewa-
tertreatmentplant(Osterholz-Schambeck,Germany)wasaddedto800mldefinedanoxic
freshwatermediumcontaining5mmolnitrate(afterWiddelandBak,1992).Aselectron
donor,weadded1%(v/v)p-xylenein50ml2,2,4,4,6,8,8-heptamethylnonane(HMN).A
controlculturewaspreparedwithoutp-xylene.Culturesweresealedwithbutylrubberstop-
persthathadnocontactwiththeorganicphase,andincubatedat28°CunderaN2/CO2
atmosphere(90/10,v/v).Asubsequenttransferwith10%(v/v)inoculafromtheinitialen-
richmentcultureswasincubatedwith5mMnitrateaselectronacceptorand1%p-xylene
(v/v)aselectrondonor.Mud-freecultureswerecontinuouslyincubatedundermoderate
pm).r(80shakingFurthermore,frommud-freeculturesweattemptedisolationbyfourconsecutivedilution-
to-extinctionseriesestablishedin156mlserumbottles.Theseconddilution-to-extinction
wasdonewitha1to2dilution,andtheremainingserieswitha1to10dilution.Each
subsequentserieswasinoculatedfromthehighestdilutionthatprovidedagrownculture.
Isolationwasattemptedinsolidagar,overlaidwith10%HMNascarrierfor1%p-xylene,
colonieswerepickedandculturedindenitrifyingliquidmediawith1%p-xyleneinHMN
(v/v).Fivecoloniesgrewinliquidmedia,butwerelostatsubsequenttransfers.
GrowthtestswereperformedwiththefollowinghydrocarbonsinHMN(conc.arev/vin
%):benzene(0.5),toluene(1),ethylbenzene(1),o-andm-xylene(1),2-methylnaphthalene
(2),naphthalene(2),limonene(1),n-hexane(0.5),cyclohexane(0.5),n-decane(0.5).In
additionwetestedcholesterol(granules),o-,m-andp-methylbenzoate(each5mM),ben-

133

3iptuscrMan12zoate(5mM),fumarateandlactate(each10mM).
Theconsumptionofp-xyleneandnitrate,formationofnitrite,nitrousoxide,andcelldry
mass,weremeasuredinculturesgrownin400mlmedium,12%(v/v)inocula,and40ml
HMNascarrierfor0.2%p-xylene(v/v).Inoculatedmediawithoutp-xyleneandmediawith
p-xyleneandwithoutinoculaservedascontrols.Celldrymasswasquantifiedasdescribed
elsewhere(RabusandWiddel,1995).

ysisanalChemicalAllsamplesforchemicalanalysisweretakenwithN2flushedhypodermicneedlesand
.ingessyrNitrateandnitritesampleswerediluted1:10priortoionchromatographyonaSykam
HPLCIBJA3anionexchangecolumn(4×60mm)(Sykam,Munich,Germany).Separation
underisothermalconditions(50°C)wasachievedwith20mMNaClin45%ethanolata
flowrateof1mlmin−1.Nitrate(retentiontime3min)andnitrite(2.1min)weredetected
at220nmonaLINEARSpectrophotometer.ThesignalswereprocessedwithDataApex
ClarityHPLCSoftware(GammaAnalysenTechnikGmbH,Bremerhaven,Germany).For
fastmonitoring,MerckoquantTestStrips(Merck,Darmstadt,Germany)wereusedtodetect
consumptionofnitrateandnitrite.Ammoniumwasdeterminedcolorimetricallyasdescribed
elsewhere(Weatherburn,1967).
N2OgaswasdetectedonaShimadzuGC-8AgaschromatographequippedwithaPo-
raplotQcolumn(length2m,innerdiameter3mm).ThecarriergaswasN2andtheflow
ratewas32ml/min.Separationoccurredisothermallyat40°C,withtheinjectorportand
thethermalconductivitydetectorat110°C.
p-Xyleneconcentrationsweremeasuredbyhead-spacegaschromatographywhenall
threephases(gaseous,HMNandaqueous)wereinequilibrium(adaptedfromMusatand
Widdel,2007).Gasvolumesof0.1mlwerewithdrawnat28°CandinjectedintoaShimadzu
GC-14B(Duisburg,Germany)equippedwithaSupel-QPLOTfusedsilicacapillarycolumn
(length30m,diameter0.53mm)andaflameionizationdetector.Isothermalseparation
wasperformedat200°CwithN2ascarriergas,theinjectorat150°CandtheFIDat280°C.
Samplesforvolatilefattyacidanalysiswerefilteredanddiluted1:10beforeinjectiononto
aSykamHPLC(Fürstenfeldbruck,Germany)equippedwithanAminexHPX-87HHPLC
column(300x7.8mm).Theeluentwas5mMH2SO4.Theseparationwasisothermalat
40°CwiththeUVdetectorat210nm.
Metabolitewereextractedfrom100mlofcellsdisruptedbyheatingat85°Cfor40
min.SampleswereacidifiedtopH1withH3PO4priortoextractionwithdichloromethane
(DCM).TheDCMextractwasdriedwithanhydrousNa2SO4andderivatizedpriortogas
chromatographic-massspectrometric(GC-MS)analysisusingasolutionofdiazomethane
indiethylether.GC-MSmeasurementswereperformedusingaTraceGC-MS(Thermo-
electron,Dreieich,Germany)equippedwithatemperature-programmableinjectionsys-
temandaBPX5fusedsilicacapillarycolumn(length50m,innerdiameter0.22mm,film

134

thickness0.25μm).Heliumwasusedascarriergas.TheGCoventemperaturewas
programmedfrom50°C(1minisothermal)to310°C(30minisothermal)atarateof3°
perminute.Themassspectrometerwasoperatedinelectronimpactmodeandatanion
sourcetemperatureof230°C.Fullscanmassspectrawererecordedoverthemassrange
of50to600Daltonatarateof2,5scanspersecond.

ysisanalMolecular

ExtractedandpurifiedgenomicDNAfromhighlyenrichedcultures(Zhouetal.,1996)was
usedtoamplifythealmostfull16SrRNAgenesequencewithspecificbacterialprimers,
8F(Hicksetal.,1992)and1492R(Kaneetal.,1993).ThePCRproductswerecleaned
withaQIAquickPurificationKit(Quiagen,Hilden,Germany)clonedintopCR4-TOPOvec-
tor(Invitrogen)andtransformedintoTOP10chemicallycompetentE.colicells(Invitrogen).
PositiveclonesweresequencedusingtheABIPrismBigDyeTerminatorvs.3.0cyclese-
quencingkitandanABIPrism3130XLGeneticAnalyser(AppliedBiosystems).Sequences
werecleanedofvectordatawithSequenceAnalysis5.2(AppliedBiosystems)andassem-
bledintofulllength16SrRNAsequencesusingtheSequenchersoftware(GeneCodes
Corporation).16SrRNAgenesequenceswerealignedwiththesequencesintheSilva
databasevs.94(http://www.arb-silva.de)usingtheARBsoftwarepackage(Ludwigetal.,
2004;Pruesseetal.,2007).Differentphylogenetictreeswerecalculatedwithnearlycom-
pletesequences(morethan1300nucleotides)bymethodssuchasmaximumlikelihood
(ML),maximumparsimony(MP)andneighborjoining(NJ).
Twoprobesforfluorescenceinsituhybridization(FISH),pxyn-440andpxyn-644,were
specificallydesignedforthemostdominantphylotypeinourclonelibraries(ARBPROBE
DesignTool).ProbesweretestedinsilicoagainstRDPIIdatabaseversion9.48(http://rdp.-
cme.msu.edu/probematch/search.jsp).Astwomismatchcontrolforthespecificityofpxyn-
440strain72Cholwasused(HarderandProbian,1997).Probepxyn-644didnotmatchany
cultivatedmicroorganisminthedatabase.Specificityoftheprobeswasensuredat40%
formamideduringhybridizationexperiments.NestedFISHwasperformedwithphylumto
group-specificprobes(Table12.2)asdescribedelsewhere(Amannetal.,1995).Allprobes
usedweresynthesizedwitha5’-Cy3modification.

NucleotidesequenceaccessionnumbersFM207901toFM207960aretheEMBL-EBI
accessionnumbers,of16SrRNAgenesequencesretrievedfromtwodifferentenrichment
culturesthrivingonp-xylene.

135

uscrMan123iptdiscussionsandResults

ationcultivandhmentEnricSediment-containingenrichmentcultureswith1%p-xyleneinHMNasorganicenergy
sourceconsumedtheinitialnitrateadded(5mM)after80days.Nitrate(5mM)wasre-
suppliedseveraltimes.Thep-xylene-freecontrolcultureconsumed25mMofnitratein
cca.450days,thennitratereductionceased.Incontrast,enrichmentswithp-xylenecon-
tinuedtoreduceupto50mMnitrate.After650days,p-xylenewasnolongerdetectedin
thesecultures.Consecutivesubculturesconsumed13to27mMnitratewithin270days.
Thesubcultureswiththehighestcumulativenitratereductionwereusedasinoculafor4
successiveliquiddilutions-to-extinctionseries,whichresultedinsediment-freehighlyen-
richedcultures.Growthwithp-xyleneandnitrateinhighlyenrichedculturesbecamefaster
anddoublingtimesofapproximately7dayswereobserved.Theseenrichmentsweredom-
inatedbythincurvedrods,0.5μm×2μm.

Growthtestsonotherhydrocarbons
Ofallthetestedhydrocarbons,besidesp-xylene,onlytoluenesustainedgrowthandden-
itrification.Culturesdidnotutilizethefollowinghydrocarbons:benzene,ethylbenzene,
o-xyleneandm-xylene,2-methylnaphthalene,naphthalene,limonene,n-hexane,cyclohex-
ane,orn-decane.Othersubstrateswhichwereutilizedbyourenrichmentswerep-toluic
acid,benzoate,fumarateandlactate.Culturedidnotthriveoncholesterol,ando-and
m-toluicacid.Culturesgrownonp-toluicacidandtoluenewererepresentsbyasimilar
morphotypelikep-xylenegrowncultureswhilstmorecellmorphologieswereobservedin
culturesgrownonsubstratessuchasbenzoate,fumarate,andlactate.
Anaerobicpurecultureswithp-xyleneaselectrondonorhavenotbeenobtainedyet,
whereaspureculturesofdenitrifiersandsulfate-reducerswhichutilizetheothertwoxylene
isomersarereadilydescribed(Harmsetal.,1999;RabusandWiddel,1995).m-Xylene
isthemosteasilydegradedofthexyleneisomersandsomemicroorganismsisolatedon
thishydrocarbonarethesulfate-reducingstrainmXyS1(Harmsetal.,1999),andtheden-
itrifyingstrainmXyN1(RabusandWiddel,1995).o-Xyleneislesspronetodegradation,
howeversomesulfate-reducingstrains,suchasOX39(Moraschetal.,2004)andoXyS1
(Harmsetal.,1999),wereisolatedonthismonoaromaticcompounds.Althoughthese
strainsweretestedforgrowthonallxyleneisomers,onlystrainOX39wascapabletogrow
withtwodifferentxyleneisomers,o-andm-xylene(Moraschetal.,2004).

degradation-xylenepofQuantificationCatabolismwasquantitativelymonitoredfor80daysinculturesgrownwithalowamount
ofhydrocarbon(Table12.1).Culturesincubatedwithp-xyleneconsumedallnitrateadded
(Figure12.1).Toelucidatewhethernitrateisreducedtoammonium,wemeasuredthe

136

ammoniumconcentrationinthecellculturemedium.Attheendoftheincubation,ammo-
niumdecreasedby1μM.Todeterminewhethernitrateisreducedtodinitrogengas,we
lookedafterintermediates,likenitriteandnitrousoxide.Theconcentrationsofnitritedid
notchange,anddinitrogengaswasnotdetectedduringcultivation.
Thenitrateconsumedbyap-xylenedegradingculturewas3.46±0.07mmolwhich
couldaccept17.3±0.3mmolofreducingequivalents(Table12.1)ifcompletelyreduced
todinitrogengas.Thephysicallossofp-xylenewaslow,asobservedinasterilecontrol.
Fromdryweightmeasurements,weestimatedthat2.2μmolp-xylenewereassimilated
intobiomass(seeTable12.1).Theamountofp-xyleneincorporatedintobiomasswas
calculatedusingtheassimilatoryreaction:17C8H10+32HCO3−+32H++30H2O→
42C4H7O3.Thetotalamountofp-xylenecatabolizedwasof0.50±0.08mmol,which
coulddonate20.9±3.3mmolreducingequivalentsifcompletelyoxidizedtocarbondiox-
ide.Thecompleteoxidationofp-xyleneaccordingtotheequationC8H10+8.4NO3−+
8.4H+→8CO2+4.2N2+9.2H2O(ΔG0’is-4202.6kJmol−1p-xylene),issupported
bytheelectronbalance(Table12.1)andalackoffattyacidsaccumulationintheculture
media.Hereweshowforthefirsttimethestoichiometriccouplingofp-xyleneoxidationto
nitratereduction.Anotherstudyproposedacompleteoxidationofp-xyleneunderdenitri-
fyingculturesbasedonsimilarratesofelectrontransferredfromtheelectrondonortothe
electronacceptor,duringexponentialgrowth(Haneretal.,1995).Whereasundersulfate
reducingconditionsp-xyleneoxidationwasstoichiometricallycoupledtoreductionofsul-
fate(MoraschandMeckenstock,2005;Nakagawaetal.,2008).Althoughconsumptionof
p-xylenewasalsodetectedunderironreducingandmethanogenicconditions,theprocess
hasnotbeenstudiedquantitatively(BottonandParsons,2007).

Mechanismofp-xyleneactivation
Inacidifiedandmethylatedextractsofculturesgrownwith5mMnitrateand2%p-xylenein
HMN(v/v),twometabolitesweredetectedasdimethylesters.Basedonrelativeretention
times,massspectraandcomparisontopublishedspectra,weidentifiedthetwodimethyl
estersinourdenitrifyingculturesasdimethylestersof(4-methylbenzyl)succinate,and(4-
methylphenyl)itaconate.Themassspectraof(4-methylbenzyl)succinicaciddimethylester
showedthemolecularionatm/z250,thebasepeakatm/z105andfurtherkeyfragment
ionsatm/z131,145,177and190(Fig.5A).Themassspectrumof(4-methylphenyl)
itaconicaciddimethylestershowedthemolecularionatm/z248,thebasepeakatm/z
129andfurtherkeyfragmentsatm/z115,188and216(FigureSM12.6).
Theirmassfingerprintsweresimilartothecompoundsfoundinsulfatereducingen-
richmentsdegradingp-xylene(Elshahedetal.,2001;Moraschetal.,2004;Moraschand
Meckenstock,2005).Thepresenceofthesemetabolitessuggestasimilardegradation
pathwayasdescribedfortolueneandm-xyleneinthedenitrifiersThaueraaromaticaand
Azoarcussp.strainT,respectively(Biegertetal.,1996;Kriegeretal.,1999;Leuthnerand
Heider,2000).However,afterringcleavage,thepara-methylgroupwouldpreventonestep

137

3iptuscrMan12ofregularβ-oxidation.Themechanismbywhichthis„obstacle“isby-passedisunknown.

Phylogenyandcellhybridization

Toidentifythephylogenyofmicroorganismsintwohighlyenrichedp-xylenedenitrifyingcul-
tures,pXyN1andpXyN3,weconstructed16SrRNAgenelibraries.Theclonelibrariesof
theseenrichmentsweredominatedbyonephylotype(≥98.5%sequenceidentity)(Figure
12.2).ThisphylotypewascloselyrelatedtotheBetaproteobacteria,Denitratisomaoestra-
diolicum(95%identity).Othercloserelativesincludestrain72Chol(94.4%)andSterolibac-
teriumdenitrificans(94.2%).ThisphylotypewasonlydistantlyrelatedtotwoAzoarcus
members:thecyclohexane-1,2-dioldegradingstrainLin22(91.4%),thepropylbenzenede-
gradingstrainPbN1(90.9%)andtoDechloromonasaromaticastrainRCB(91.1%).From
theThaueragrouptheclosestrelativeisthetoluenedegrader,ThaueraaromaticaK172.
Otherfivephylotypeswerefound,threerelatedtoDenitratisomaoestradiolicum(84.4to
94%),onetoChlorobiumphaeobacteroidesDSM266(80%identity)andonetocandidate
divisionOP11sequencesfromariverestuarymangrove(89.8%identity)(FigureSM12.5).
Toresolvetherelativedominanceoftheorganismsintheenrichments,weappliedFISH
withphylum-togroup-specificoligonucleotideprobes(Figure12.4).Allbacteriawerede-
tectedwithaDNAstain(4’.6-diamidino)2-phenylindol(DAPI).Wedeterminedtherelative
percentageofprobetargetedcellsinrelationtothenumberofDAPIstainedcells.The
generalBacteriaprobe(Eub-338I-III)hybridized97%ofthetotalcellsinbothenrichment
cultures(Figure12.3A).TheclassspecificBetaproteobacteriaprobe(Bet-42a),hybridized
tomorethan93%cellsinbothenrichments(Figure12.3B).Newlydesignedprobes(pxyn-
440andpxyn-644)specificfortheDenitratisoma-relatedphylotypewhichdominatedboth
clonelibraries,targetedmorethan91%ofcellsinbothenrichmentcultures(Figure12.3C).
WithintheBetaproteobacteriaclass,AzoarcusandThaueraclade,comprisesallde-
scribeddenitrifyingalkylbenzenedegraders(WiddelandRabus,2001).Incontrast,the
dominantmicroorganisminourdenitrifyingcultureswasonlydistantlyrelatedtoAzoarcus
andThaueraspecies.Thenextrelativesatthe16SrRNAlevelaredenitrifyingmicroorgan-
ismscapableofsteroiddegradation,the17-estradioldegraderD.oestradiolicum(Fahrbach
etal.,2006),andtwocholesteroldegradingisolates,S.denitrificansandstrain72Chol
(HarderandProbian,1997;TarleraandDenner,2003).Inanotherstudythedominantphy-
lotypeofdenitrifyingbenzenedegradingenrichmentcultures,wasalsorelatedtoasteroid
degrader,Sterolibacteriumdenitrificans(UlrichandEdwards,2003).Untilnow,theabilityof
steroiddegraderstousemonocyclicaromaticsisunknown.Ourenrichmentswerecapable
togrowontwoalkylbenzenes(toluene,p-xylene)andtwopolarmonoaromatics(benzoate,
p-toluicacid),anddidnotutilizecholesterol.Thesephysiologicalandphylogeneticdiffer-
encessuggestthepositioningofthedominantphylotypeinanewgenuswithinthefamily
.Rhodocyclaceae

138

wledgmentsknoAc

TheauthorswishtothankProf.FriedrichWiddel,Dr.FlorinMusat,andDr.NiculinaMusat

forhelpfuldiscussionsandcriticalreviewofthemanuscript.WethankDr.NiculinaMusat

forintroductionandhelpwiththeARBsoftware,MelissaDuhaimeforproofreadingthe

manuscript,UlrikeJaekelforprovidingphasecontrastmicroscopyphotos,OlavGrund-

mann,AnkeSobottaandCorneliaKargerforassistancewithGC-MSanalysis.Thiswork

wassupportedbytheMax-Planck-Gesellschaftand,

kPlanc

Research

School

fro

ineMar

.Microbiology

partly

through

the

nationalInter

Max

139

uscrMan123ipt

lestabandFigures

140

Figure12.1:Nitratereduction(filledup-triangles)andopticaldensity(filledcircles)increase(panel
A)inasedimentfreeculture,pXyN1whichdegradesp-xylene(filleddown-triangles
inpanelB).Inaninoculatedcontrolthereisnosignificantdecreaseofnitrate(opened
up-triangles).Insterilecontrolsnomajorhydrocarbonlosshasbeendetected(open
down-triangles).Thevaluesfornitrateandp-xyleneareaverageofduplicatemea-
.surements

Figure12.2:MaximumlikelihoodtreeofBetaproteobacteriashowingthedominant16SrRNAphy-
lotype(grayboxes)intwoenrichmentcultures(pXyN3andpXyN1)grownonp-xylene
assoleenergysource.ThearrowpointstoDeinococcusspecieswhichwereusedas
out-group.Thescalebarmeasuresdistanceas5%similarityperbarlength.

Figure

12.3:

Microscopicimagesofcellsinadenitrifyingenrichmentculturewithp-.xyleneImagesA,BandCaresuperimposedDAPIandprobesignals.Cellsnottargetedbytheoligonucleotideprobeappear
blue(DAPIsignal)whileprobe-targetedcellsappearred.Thescalebaris5μm.A)Cellsstained
withDAPIandhybridizedwithaBacteria-specificprobemix(EubI-III).B)CellsstainedwithDAPI
andhybridizedwithprobeBet42aspecificforBetaproteobacteria.C)CellsstainedwithDAPIand
hybridizedwithprobepxyn-440designedforthedominantphylotyperetrievedfromtwop-xylene
degradingenrichments.D)Phasecontrastmicrographofviablecells.

141

12

Man3iptuscr

142

Figure

12.4:

umerEnationofcellsstainedhighlyculturesifyingdenitr

,probe

.here

Non-338,

although

withCy-3labeledprobesp-onichedenrxylene

applied

it

stained

0%

ersusvAPIDstainedcellsinotwnonsenseThepXyN3).and(pXyN1

,cells

oretheref

it

is

not

represented

-xylenepHMNin0.2%tocorrespondingmmol0.616sawadded
atenitrandconsumptionxylenep-400ofolumevcultureain25%sawinoculaThe.culturesichedenrhighlyotwinreduction
ofamounttheoreticalThe.-xylenep
ofQuantificationrofiercarrasHMNml40withlaidervoml,mmol.4sawaddedatenitrofamounttheoreticalThe(v/v).
12.1:elbaT

(%)eredElectronsvreco(mmol)donated**Electronsaccepted***(mmol)Electrons(mg)ydrCellmass-xylene(mmol)consumed*pinitial(mmol)xylenep-(mmol)−3NOconsumed*initial−3(mmol)NOCulture

1622±±964.00±833.30±
±18.00.0320.90.03±
0.460.05±0.530.02±-----0.05±
±0.490.010.570.00±0.030.05±---0.11--0.07±
17.20.560.08±17.30.580.06±
0.503.620.01±3.650.03±0.06±0.18
--xylene3.62(A)-xylenep3.65(B)-xylenep3.58-xylenep
pwithCellswithCellsileSterwithcontrolwithoutCells

Thecontrol.ilesterainlostxylenep-
cellmg2.1assumedeWdisappeared.thatxylenep-ydr.
3O7H4Cactingsubtrybculturesichmentenrybconsumedxylenep-the−3
42→considercalculatederewxyleneactingsubtrybcorrectedsawusedatenitrofamountThe.culturesybusedsourcesenergytheseofamountstheingp
O20H+3+2H+3saw-xylenetotalthefrombiomassintoassimilatedamountthexcludingeybcalculated
OC2H+310H8*.oneinitialthefromaluevmeasuredfinaltheactingsubtrybcalculatedsawp-xyleneandatenitrofdepletionTheybdonatedandatenitrybaccepted**Electronsofamountthecorrectedew,lySimilar.culturecontrolinoculatednanidevobseratenitroflosstheofdissimilationingdurdonatedelectronsofamountmmol0.0039requiresmass
theingconsider-xylenepCreaction:17assimilation
p-

143

Man123iptuscr

144

usedsawprobeThis**inofamountequimolarnA*

equimolarEub-338(I,IIamountandIII)withwasanusedunlabeledtoenumerGam-42aatemostcompetitorBacteria.(5’-GCCTTCCCACTTCGTTT-3’),toenhancespecificity.

(644-664)16SCCGTTTCCAGGGAATTACGTpxyn-644(440-460)16SCCGTTTCGTTCCTGCTCCAApxyn-440class86%(1027-1043)23SCTTCGTTTGCCTTCCCABet-42a***order93%(338-355)16SGGTGTACCCGTGCTGCCA(III)*Eub-338order69%(338-355)16SGGTGTACCCGTGCCCAGCA(II)*Eub-338
iaBetaproteobacterucomicrobialeserrVycetalesPlanctom
40%specificylotypeph-xylenep40%specificylotypeph-xylenep
0-50%35%0-50%

Eub-338(I)*GCTGCCTCCCGTAGGAGT16S(338-355)90%domainBacteria0-50%

(Manz(Daims(Daims(AmannThisThisetetet1990a)al.,al.,al.,etstudystudyal.,1992)1999)1999)

(5’-3’)SequencenameProbesitetargetrRNA
(E.colinumbering)vcoroupgargetTmamideroFagere

References

Table12.2:OligonucleotideprobesusedforfluorescenceinsituhybridizationofenrichmentculturespXyN1andpXyN3.

Supplementarymaterial:Highlyenriched

oteobacteriaBetapr

nitrateand

12.5:Figure

umMaximlikgrowinganaerobically

elihoodtreeof16SrRNAsequencesfromotwenrichmentwith

cultures-xylenep

(pXyN3andpXyN1)grownonp-xyleneassolecarbonandenergysource.Grayboxesindicatethedifferentsequence
typesencounteredinthetwoclonelibraries.Eachclonelibrarycontained30clones.Thenumber
ofclonesofeachphylotypeismentionedinparenthesis.Deinococcusspecieswereusedasout-
group.Thescalebarmeasuresdistanceas10%similarityperbarlength.

145

12

iptuscrMan

146

3

Figure

12.6:

Massaspectrfowtoylatedmethintermediarymetabolitesobtainedfromculturesgrownwithp-xyleneassoleorganicenergysource:A)(4-

methylbenzyl)succinicaciddimethylester,andB)(4-methylphenyl)ita-

conicaciddimethylester.

erencesRef

Amann,R.,Binder,B.,Olson,R.,Chisholm,S.,Devereux,R.,andStahl,D.(1990a).Com-
binationof16SrRNA-targetedoligonucleotideprobeswithflowcytometryforanalyzing
mixedmicrobialpopulations.Appl.Environ.Microbiol.,56(6):1919–1925.
Amann,R.,Krumholz,L.,andStahl,D.(1990b).Fluorescent-oligonucleotideprobingof
wholecellsfordeterminative,phylogenetic,andenvironmentalstudiesinmicrobiology.J.
172(2):762–770.,iol.BacterAnders,H.,Kaetzke,A.,Ktmpfer,P.,Ludwig,W.,andFuchs,G.(1995).Taxonomicposition
ofaromaticdegradingdenitrifyingpseudomonadstrainsK172andKB740andtheirde-
scriptionasnewmembersofthegenusThauera,Thaueraaromaticasp.nov.andofthe
genusAzoarcus,Azoarcusevansiisp.nov.,respectively,membersofthebetasubclass
ofProteobacteria.Int.J.Syst.Bacteriol,45:327–333.
Anderson,R.andLovley,D.(1997).Ecologyandbiogeochemistryofinsitugroundwater
bioremediation.Adv.Microb.Ecol.,15:289–350.
AssociationofpetrochemicalsproducersinEurope,A.P.P.E.(2006).Aromatics-capacity
andproductiondata.URLhttp://www.petrochemistry.net/capacity-and-production-
.html.aromaticsAtkinson,R.,Aschmann,S.,andArey,J.(1991).Formationofring-retainingproductsfrom
theOHradical-initatedreactionsofo-,m-,andp-xylene.Int.J.Chem.Kinetics,23(1).
Beller,H.(2000).Metabolicindicatorsfordetectinginsituanaerobicalkylbenzenedegrada-
tion.Biodegradation,11(2):125–139.
Beller,H.,Ding,W.,andReinhard,M.(1995).Byproductsofanaerobicalkylben-
zenemetabolismusefulasindicatorsofinsitubioremediation.Environ.Sci.Technol,
29(11):2864–2870.Beller,H.andSpormann,A.(1997).Anaerobicactivationoftolueneando-xylenebyaddi-
tiontofumarateindenitrifyingstrainT.J.Bacteriol.,179(3):670–676.
Biegert,T.,Fuchs,G.,andHeider,J.(1996).Evidencethatanaerobicoxidationoftoluenein
thedenitrifyingbacteriumThaueraaromaticaisinitiatedbyformationofbenzylsuccinate
fromtolueneandfumarate.FEBSJournal,238(3):661–668.
Botton,S.andParsons,J.(2007).DegradationofBTXbydissimilatoryiron-reducingcul-
tures.Biodegradation,18(3):371–381.
Botton,S.,vanHarmelen,M.,Braster,M.,Parsons,J.,andRoling,W.(2007).Dominance
ofGeobacteraceaeinBTX-degradingenrichmentsfromaniron-reducingaquifer.FEMS
62(1):118–130.,Ecol.Microbiol.

147

3iptuscrMan12Coates,J.,Chakraborty,R.,Lack,J.,O’Connor,S.,Cole,K.,Bender,K.,andAchenbach,
L.(2001).Anaerobicbenzeneoxidationcoupledtonitratereductioninpurecultureby
twostrainsofDechloromonas.Nature,411(6841):1039–1043.
Daims,H.,Brühl,A.,Amann,R.,Schleifer,K.,andWagner,M.(1999).Thedomain-specific
probeEUB338isinsufficientforthedetectionofallbacteria:developmentandevaluation
ofamorecomprehensiveprobeset.Syst.Appl.Microbiol.,22(3):434–444.
Elshahed,M.,Gieg,L.,McInerney,M.,andSuflita,J.(2001).Signaturemetabolitesattest-
ingtotheinsituattenuationofalkylbenzenesinanaerobicenvironments.Environ.Sci.
35(4):682–689.,echnol.TEvans,P.,Ling,W.,Goldschmidt,B.,Ritter,E.,andYoung,L.(1992).Metabolitesformed
duringanaerobictransformationoftolueneando-xyleneandtheirproposedrelationship
totheinitialstepsoftoluenemineralization.Appl.Environ.Microbiol.,58(2):496–501.
Fahrbach,M.,Kuever,J.,Meinke,R.,Kampfer,P.,andHollender,J.(2006).Denitrati-
somaoestradiolicumgen.nov.,sp.nov.,a17β-oestradiol-degrading,denitrifyingbetapro-
teobacterium.Int.J.System.Evol.Microbiol.,56(7):1547.
Haner,A.,Hohener,P.,andZeyer,J.(1995).Degradationofp-xylenebyadenitrifying
enrichmentculture.Appl.Environ.Microbiol.,61(8):3185–3188.
Harder,J.andProbian,C.(1997).Anaerobicmineralizationofcholesterolbyanoveltype
ofdenitrifyingbacterium.Arch.Microbiol.,167(5):269–274.
Harms,G.,Zengler,K.,Rabus,R.,Aeckersberg,F.,Minz,D.,Rossello-Mora,R.,andWid-
del,F.(1999).Anaerobicoxidationofo-xylene,m-xylene,andhomologousalkylben-
zenesbynewtypesofsulfate-reducingbacteria.Appl.Environ.Microbiol.,65(3):999–
1004.Head,I.,Jones,D.,andRöling,W.(2006).Marinemicroorganismsmakeamealofoil.Nat.
Rev.Microbiol.,4(3):173–182.
Hicks,R.,Amann,R.,andStahl,D.(1992).Dualstainingofnaturalbacterioplanktonwith
4’,6-diamidino-2-phenylindoleandfluorescentoligonucleotideprobestargetingkingdom-
level16SrRNAsequences.Appl.Environ.Microbiol.,58(7):2158–2163.
Kane,M.,Poulsen,L.,andStahl,D.(1993).Monitoringtheenrichmentandisolationof
sulfate-reducingbacteriabyusingoligonucleotideprobesdesignedfromenvironmentally
derived16SrRNAsequences.Appl.Environ.Microbiol,59:682–686.
Kasai,Y.,Takahata,Y.,Manefield,M.,andWatanabe,K.(2006).RNA-basedstable
isotopeprobingandisolationofanaerobicbenzene-degradingbacteriafromgasoline-
contaminatedgroundwater.Appl.Environ.Microbiol.,72(5):3586–3592.

148

Krieger,C.,Beller,H.,Reinhard,M.,andSpormann,A.(1999).Initialreactionsinanaerobic
oxidationofm-xylenebythedenitrifyingbacteriumAzoarcussp.strainT.J.Bacteriol.,
181(20):6403–6410.Kuhn,E.,Colberg,P.,Schnoor,J.,Wanner,O.,Zehnder,A.,andSchwarzenbach,R.
(1985).Microbialtransformationsofsubstitutedbenzenesduringinfiltrationofriverwater
togroundwater:laboratorycolumnstudies.Environ.Sci.Technol,19(10):961–968.
Kuhn,E.,Zeyer,J.,Eicher,P.,andSchwarzenbach,R.(1988).Anaerobicdegradationof
alkylatedbenzenesindenitrifyinglaboratoryaquifercolumns.Appl.Environ.Microbiol.,
54(2):490–496.Leuthner,B.andHeider,J.(2000).AnaerobictoluenecatabolismofThaueraaromatica:
thebbsoperoncodesforenzymesofβoxidationoftheintermediatebenzylsuccinate.J.
182(2):272–277.,iol.BacterLudwig,W.,Strunk,O.,Westram,R.,Richter,L.,Meier,H.,etal.(2004).ARB:asoftware
environmentforsequencedata.Nucl.Ac.Res.,32(4):1363.
Manz,W.,Amann,R.,Ludwig,W.,Wagner,M.,andSchleifer,K.(1992).Phylogenetic
oligodeoxynucleotideprobesforthemajorsubclassesofproteobacteria:problemsand
solutions.Syst.Appl.Microbiol.,15(4):593–600.
Morasch,B.andMeckenstock,R.(2005).Anaerobicdegradationofp-xylenebyasulfate-
reducingenrichmentculture.Curr.Microbiol.,51(2):127–130.
Morasch,B.,Schink,B.,Tebbe,C.,andMeckenstock,R.(2004).Degradationofo-xylene
andm-xylenebyanovelsulfate-reducerbelongingtothegenusDesulfotomaculum.
181(6):407–417.,Microbiol.Arch.Musat,F.andWiddel,F.(2008).Anaerobicdegradationofbenzenebyamarinesulfate-
reducingenrichmentculture,andcellhybridizationofthedominantphylotype.Environ.
10(1):10–19.,Microbiol.Nakagawa,T.,Sato,S.,andFukui,M.(2008).Anaerobicdegradationofp-xylenein
sediment-freesulfate-reducingenrichmentculture.Biodegradation,19(6):909–913.
Pruesse,E.,Quast,C.,Knittel,K.,Fuchs,B.,Ludwig,W.,Peplies,J.,andGlockner,F.
(2007).SILVA:acomprehensiveonlineresourceforqualitycheckedandalignedriboso-
malRNAsequencedatacompatiblewithARB.Nucl.Ac.Res.
Rabus,R.andWiddel,F.(1995).Anaerobicdegradationofethylbenzeneandotheraro-
matichydrocarbonsbynewdenitrifyingbacteria.Arch.Microbiol.,163(2):96–103.
Reinhard,M.,Hopkins,G.,Steinle-Darling,E.,andLeBron,C.(2005).Insitubiotransfor-
mationofBTEXcompoundsundermethanogenicconditions.GroundWaterMonit.R.,
25(4):50–59.

149

3iptuscrMan12

Shiu,W.andMa,K.(2000).Temperaturedependenceofphysical–chemicalpropertiesof
selectedchemicalsofenvironmentalinterest.I.Mononuclearandpolynucleararomatic
hydrocarbons.J.Phys.Chem.Ref.Data,29:41.
Suflita,L.(2002).Detectionofanaerobicmetabolitesofsaturatedandaromatichydrocar-
bonsinpetroleum-contaminatedaquifers.Environ.Sci.Technol,36:3755–3762.
Tarlera,S.andDenner,E.(2003).Sterolibacteriumdenitrificansgen.nov.,sp.nov.,a
novelcholesterol-oxidizing,denitrifyingmemberoftheβ-Proteobacteria.Int.J.Syst.
53(4):1085–1091.,Microbiol.ol.EvTuazon,E.,Atkinson,R.,MacLeod,H.,Biermann,H.,Winer,A.,Carter,W.,andPittsJr,
J.(1984).Yieldsofglyoxalandmethylglyoxalfromthenitrogenoxide(NOx)-airphotoox-
idationsoftolueneandm-andp-xylene.Environ.Sci.Technol,18(12):981–984.
Wackett,L.(2006).Themetabolicpathwaysofbiodegradation.InDworkin,M.,Falkow,
S.,Rosenberg,E.,Schleifer,K.H.,andStackebrandt,E.,editors,TheProkaryotes,vol-
ume2,pages956–968.Springer-Verlag.
Weatherburn,M.(1967).Phenol-hypochloritereactionfordeterminationofammonia.Anal.
39(8):971–974.,ChemWiddel,F.andBak,F.(1992).Gram-negativemesophilicsulfate-reducingbacteria.In
Dworkin,M.,Falkow,S.,Rosenberg,E.,Schleifer,K.H.,andStackebrandt,E.,editors,
TheProkaryotes,volume4,pages3352–3378.Springer-Verlag,New-York.
Widdel,F.,Botius,A.,andRabus,R.(2006).Anaerobicbiodegradationofhydrocarbons
includingmethane.InDworkin,M.,Falkow,S.,Rosenberg,E.,Schleifer,K.H.,and
Stackebrandt,E.,editors,TheProkaryotes,volume2,chapter1.33,pages1028–1049.
Springer-Verlag,New-York.
Widdel,F.andRabus,R.(2001).Anaerobicbiodegradationofsaturatedandaromatic
hydrocarbons.Curr.Op.Biotechnol.,12(3):259–276.

150

sexAnne13

AnnexI.Initialsediment-containingenrichments

13.1:Figure

Denitrifyingactivitymeasuredinsediment-containingenrichments(panelA)andsub-sequentcultures(panelB)grownwith1%p-xyleneinHMN(v/v).A)Nitratereduction
startedafter80daysandpersistedforcirca670daysinsediment-containingenrich-
mentswithp-xylene(emptysymbols).Thecontrolculturewithoutp-xyleneceased
thedenitrifyingactivityafterapproximately450days(filledcircles).B)Twoofthesub-
sequentenrichments(emptyup-trianglesandsquares)grownon1%p-xylenewere
activeforcirca300days,whereastheothertwo(emptydown-trianglesanddiamonds)
ceasednitratereducingactivityafter150days.Thecontrol(filledcircles)showedno
denitrifyingactivityduringtheentireperiodofincubation.

151

sexAnne13AnnexII.bssA-likegeneamplificationandprotein
fingerprintsofp-xylenedegradingcultures
ThebssAgenewasamplifieddirectlyfromcultureswithprimersfromliterature(Winderl
etal.,2007)bssA-7772F(5’-GACATGACCGACGCSATY-3’)andbssA-8846R(5’-TCGTCGTC-
RTTGCCCCAYTT-3’).ThesequencequalityofthebssAsequenceswasmanuallyin-
spectedandacontigwasassembledusinganappropriatesoftware(DNA-baser).TheARB
software(Ludwigetal.,2004)wasusedforthealignmentandtreeconstruction.These-
quenceclosestrelativeswereidentifiedbytBLASTxanalysis(translatednucleotidequery
versustranslatedproteindatabase)(www.ncbi.nih.gov/tBLASTx)animportedintoARB.
ThealignmentwasdoneusingClustalWwithBlosum62asmatrix.Therelationshipswere
inferredbyPhylipProMLmaximumlikelihoodanalysisusingtheDayhofffilter.Preparation
ofproteinextracts,SDS-PAGEandCommasiebluestainingwereperformedasdescribed
(RabusandHeider,1998).

GAAGCGGCCAAGCGCATCCGCACGCCAGAGCCCTCGATCGTATTCCGCTACTCGAAGAAGAACAGGGAAAAGACCCTGCGCTGGGTGTTCGATTGCGTCCGCGACGGCCTCGG
CTATCCGTCGATCAAGCACGACGACATCGGCACGCAACAGATGAAGGATCTTGGCAAGTACAGCCTCACTGGCAACGGCGCCACCGATGCGGAAGCGCATGACTGGGCGTGTGT
CTTGTGCATGTCGCCTGGACTGGCTGGCCGCCGCAAGACGCAGAAAACCCGTTCCGAAGGCGGGGGGTCGATCTTCCCGGCGAAAATCCTGGAAATCACTTTGACCAATGGATA
CGACTGGTCCTACGCCGATATGCAGCTTGGCCCGAAGACCGGAGATATCTCGACATTCAAGACCTTCGAAGACGTCTGGGAAGCTTTCCGCAAGCAATACCAATACGCCATCAAT
CTGTGCATCAGCACCAAGGATGTTTCACGCTACTTCGAAGGCCGCTATCTGCAGATGCCCTTCGTCTCCGCGATCGACGACGGCTGCATGGAGTTGGGTGCCGAGGCCTGCGC
GCTGTCCGAGCAACCGAACGCTTGGCACAACCCGATCACCACCATTGTGGCGGCCAATTCGCTGGTCGCCATCAAGAAACTGGTGTTCGACGACAAAAAGTACACGCTTGAGCA
ACTCACCGAGGCGCTGTTGGCCAACTGGGAAGGGTTCGAAGAGATGCGTGTAGCCTTCAAAAAAGCGCCGAAGTGGGACAAAAACAACAAACGGTTTCCTTGATGGCAACCCCA
TCGGGTTTGGTGGTGACAATTGGCCGCCAGCGAA

Figure13.2:BssAsequenceretrievedfromp-xylenedegradinghighlyenrichedcultures.

Figure13.3:ProteinprofilesofenrichmentculturepXyN1grownwithdifferentsubstrates(PanelA).Arrowspointatthe
positionwheretheα-subunitof(alkylbenzyl)succinatesynthasecouldmigrateaccordingtoitssizeinSDS
denaturinggels.Adualbandαofthisproteinisexpectedtooccurduetooxygenolyticcleavage.Thisdual
bandwasvisibleonlyintolueneandp-xylenegrownenrichments,howeveritwasabsentfrombenzoateand
fumarate(notshown)growncultures.TomakesurewelookattherightmigrationbehaviorweusedstrainHxN1
thathasa(methyl)succinatesynthasewhichmigratesaround95kDa.ThearrowinpanelBpointsattheα
subunitofMssA.However,thedoublebandsfromourenrichmentsweredistantfromMssA.

152

wledgmentsknoAc14

ou!yThankMyPhDsupervisor,PDDr.JensHarder-forbelievinginme,andforgivingmethe
opportunitytoworkonthisproject.
Prof.FriedrichWiddel-forhelpfuldiscussionsduringmyPhD,correctionsofmyfirst
paper,andforreviewingmythesis.
Mythesiscommitteemembers-Dr.JensHarder,Dr.BernhardFuchs,Prof.Dr.Ulrich
Fisher,andDr.FlorinMusat.
Mylab-rotationstudentsPaolaandUlrikefortheirwork,andespeciallyUlrike,formaking
wonderfulphasecontrastphotosandhelpingtosequencethebssA-likesequence.
MyofficematesAlex,Maya,Jacob,andlaterMathiasandMarcel,formakingtheoffice
aspacededicatedtopeaceandthinking,butalsoforlaughsandardentdiscussions.
CristinaMorarufor„FISHemergency“-helpandcookiechats.
My„RomanianfamilyinBremen“,NiculinaandFlorinwhoweremyinspirationandgave
mecomfortandstrengthwheneverIneededit.
MybestfriendAlbertowhosharedcoffees,„super-sandwiches“,ideasanddreamsabout
.elifandscienceMyfriendAdriana,whowasthereattheotherendoftheline,sometimeforhours,listen-
ing,understandingandpassingthroughasimilarstruggle.
MyfriendsthatmadethelifeinBremenajoy:Melissa,Steffi,Gulcin,Luciana,Pablo,
.xxyoFGabi,MywonderfulboyfriendStefanwhosestrength,loveandcarekeptmegoingoverthe
.timesdifficultmostFamilieimelecarem-auajutatsaajungaici.Mameimele,Crinasitataluimeu,Nicolae,
pentruincrederesiputere,darsipentrudragosteapentrunaturacladitatreptatdecand
eramde-oschioapa;bunicilormei,Lucretia,siTituscaremi-aupuscreionulinmana.
Soreimeledragi,Diana,pentruveseliasidragosteapecareleemana-caredemulteori
m-aueliberatdin„inchisoareaproprieitristeti“.Defaptiimultumescintergiimelefamilii
caremi-aufostapropeinsufletlabinesilagreu.

153

14

wledgmentsknoAc

154

AnlagezurDissertation

uRotarAmelia-ElenaName:ift:Anschr

ungklärEr

Ort,Datum:Bremen,30April2009

gem.§6(5)Nr.1-3PromO

Icherkläre,dassich
1.dieArbeitohneunerlaubtefremdeHilfeangefertigthabe,
2.keineanderen,alsdievonmirangegebenenQuellenundHilfsmittelbenutzthabeund
3.diedenbenutzenWerkenwörtllichoderinhaltlichentnommenenStellenalssolcheken-
.habegemachtntich

ift)(Unterschr

155